Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YI17FM1
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00003207001 E-value : 1e-137
Numbers of ESTs : 1

Blast Results:

Nr Definition: heavy metal ion transporter, putative
Accession: ref|XP_001264877.1| Score: 204 E_value: 1e-14
KEGG Definition: iron/copper transporter Atx1, putative
Accession: afm:AFUA_1G08880 Score: 201 E_value: 2e-14
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1603 Score: 138 E_value: 2e-09
PFAM Definition: HMA, Heavy-metal-associated domain..
Pfam Number: pfam00403 Score: 127 E_value: 3e-08
Swissprot: P38636|ATX1_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0016531 = Molecular function: copper chaperone activity
GO:0006879 = Biological process: cellular iron ion homeostasis
GO:0006825 = Biological process: copper ion transport
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>SY0AAA53YI17FM1
TTGGCAACCACCCCTCGCACCATCAAGGGTGAAACTACCGGTAGCGCAAA
AACATGCTCAACGCCCGTATCCTGTGCGAGTACTCGAGTACGGTAGATTA
GTATCGGAAAGGGGCTTCTCACCCTGCGGGCAGCGGGACTAATCCCGCCG
CGTTCCTTTGTGCTTACCGGTAGGGGGATCCTCTGTCATTGTATGAGAAC
CTCATAGTTACCTCACCTCACATCTCGACGCAGTACGACGCAACGAGGTA
AAGAAGAGTCAACAAACGAATAAACAAAGAAAAAGAATCAAGATGCGAAA
CTACCAGTTCACTGTCGCCATGTCCTGTGGCGGGTGTTCAGGTGCTGTAG
ACCGGTCATTGAAGAAACTTGAGGGGGTGGAGGACTTGAACATCGACCTC
GATACCAAAATTGTCAAGGTCACCACCAACGATACTCTAAAATACGAGGA
TGTTCTAGCGCAGATCACAAAGACTGGGAAGAAGGTCACCGAAGGGAATG
AAGAGGTTGACGGAGCTTTGCAGAAGAGGAAGGTTTAAATTAGGAGCTGG
TGGTAGTTCCTTTTCTGTTTCTTTGTTTGATGGCCATGAATGGCTATGGG
TAGTTTGGGGCTCTATATCTTTTCTGTTTTCTTTGTTTTACGACTACCGG
ATTCGAAGGGTCATAGTACCAAGGTTTTTTCTGGTTGAA

Sequences in the Contig:

SY0AAA53YI17FM1