Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YI01FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00008306001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539038.1| Score: 132 E_value: 2e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG10725.1 Score: 130 E_value: 2e-06
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 114 E_value: 7e-07
PFAM Definition: AF-4, AF-4 proto-oncoprotein. This family consists of AF4 (Proto-oncogene AF4) and FMR2 (Fragile X E mental retardation syndrome) nuclear proteins. These proteins have been linked to human diseases such as acute lymphoblastic leukaemia and mental retardation. The family also contains a Drosophila AF4 protein homologue Lilliputian which contains an AT-hook domain. Lilliputian represents a novel pair-rule gene that acts in cytoskeleton regulation, segmentation and morphogenesis in Drosophila..
Pfam Number: pfam05110 Score: 111 E_value: 2e-06

Sequence:
>SY0AAA53YI01FM1
TTGGATGATGGAAGGCGATTTGAACCTCTCCCAGGCGCTGGGTGGCCTCA
GGATCGCAAATCAGACAGACGACTCACCACCCTCGTCGCCTCGTGATGCT
GGAGCTTCGAATAATTCCCAATCTCCTTCAATACATATCCCTGATCTCCA
ACAGCTCTCACCTCGGACTCCAGAATCACATTCACCACACACTCCCAGTA
CCTTATCCCAGACACCACCGTTAGGGCCTTCCTCGCAACTTCGGCAGTCC
GCTGCCTACCCCCCGCCTACCCCTCCGTCACGGCCCGCCTCTCAGTATCT
AGGATCCTCCTACACGTCAGGACCTTCAACTATTTACCATCCACAGAATG
TTTCCTCCACTGGCTCTGTCTCTTCCATTAACCCCCTGATGCATCCAGAC
TACGCTCGCATTTCTCGTGAGCCTTCAAGATCCTCGCTCTCAGGGCCGTC
AATGGGGGCAAACAGGCAATCTCAGAGGGAGCGTTCAAATACCGATAGGT
CTTATCGACAATCAGGTCCAACAGGTCCGTACTCCCCTCGTGGTTCTAGC
AGAGTAATGGCCCAATCAGGATC

Sequences in the Contig:

SY0AAA53YI01FM1