Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YH17FM1
Length(NT) : 631
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG08155.1
Accession: ref|XP_388331.1| Score: 169 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG08155.1 Score: 169 E_value: 6e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 130 E_value: 1e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YH17FM1
TTGGAGCCTGTCTGACATACCTCAACTTTCGCACTATTAAGGAGATACCG
CCCACAGTCTTTGCCCCCCCTCAGTCAACCGCCTTCCTCAATTATTCTTC
CCTATATTGGGGGGCCCACGCTAGGAGACATGCTTCGAGGGAGGTGGTAT
CACTCGCACTTAAGCTGTTCAGCCAGATTGAAAGCCATATATTTACTAAA
TTGCTTTTGAAGGATCTCATATCGAGAACCAGTCGAGGTAGTCATGATAT
CCCTATTAGCGGTCATTTGGTCGGGTTTACTGGACTGCATTGTGCGTCAG
TTTTCGGAATTGCGGAGATCGCCACTACTCTCATGGGTCAGCCAAATTCG
GATTTCAACAAAACGGATTTTCTTGGTATTACACCGCTCATATGGGCTGT
GATATGTGGACGAGATGAGGTAGCGAAACTACTACTAGAACAGCAGACCG
TCATCCCCGACAAACCCGATAATTTTTTTCATCGATCACCGCTCTCCTGG
GCTGCTGGGAAGGGACATGAAGGGATGGTGCGGTTGTTTCTTGGCCTGGG
ATATGCCACACCCACTGGGGCAGGTGGCTGGTGGGGTAAGACGTCCCGAC
TGCTGAACAGGGTCCTGGGAAGGAGATATGT

Sequences in the Contig:

SY0AAA53YH17FM1