Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YH14FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00010876001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001228323.1| Score: 265 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: fgr:FG04419.1 Score: 264 E_value: 7e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YH14FM1
TTGGTATAAAGTGGTCTACGGAAAACCAATTGATAAAACCATCATCTGTT
GTTTCACCCTCTCTTCCACCTCCGCCGTGTGGACTCTTGCCTGGAAACAG
GTAATCTTTAATACTACATCCTTTTCTATCAAAACAGAGTCTGCCCAAGG
CGAGCACTCCAAAACCAAACCTGACTCCTTAGACTTTCTGAAGCAAGCAA
GGAGGGAGCCATCTGAACGATAGGATGAGCCAACTATCAGGTGTAAATTC
GATCAAGATCGGGATAGACTTTGGAACGACATATTCTGGTATAGCTTGGG
CCTACAGCTCTACTCCCGAGAAGGTCAATGTCGTTGGTAAATGGGTCGCT
GGGAGAAGCAGGACATCTGGAAAGGCGCCTAGCGAGATAGCGTACACGTC
GTCAGGTGTGAAATGGGGATTTGGAATTCCCATTAAAGAGCCAACGCTCA
CTTGGTTTAAGCTTCTCCTGGACCCTACCAAATATCCTCTCGCCAACTCC
ACCAATTCACCCTTGGCGAGGACAAAGCAGCTGATACCCCACGGGAAGAA
CCCAGTCGATGTTGTAGCCGATTACCTGTCTGAGTTATACAAGCACACCA
TCAATCATCTGGAGAAGACCCTTGGGAAAAGTACTGTTGAAGTCTCGCCC
CTTGATTTTGTTCTCA

Sequences in the Contig:

SY0AAA53YH14FM1