Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YH12FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00000709001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01845
Accession: ref|XP_001248074.1| Score: 265 E_value: 9e-22
KEGG Definition: hypothetical protein
Accession: ang:An07g06535 Score: 230 E_value: 5e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YH12FM1
TTGGACCAAACCAGCCTTATCGGTTTAACGGTAACGGCGCTATGGCAGCA
GCCCTCTACCCCCCACGCGTCGAAGAAGATATATTGAAAGCTGAAGAAGA
ATCTGGCGTCCGAGAGCTAGCCTGGCTTCTGGACACCCTGCAGGAAACAG
TCGACAATGTCCGCTCTGGCCTGCGAGAGTGCTCCAACCTCCTCGCATCG
AGCACAGGCTCTACGCTAGTTCTTTCCTCACCGCGCTCGGAGTCACTCAA
GGGGTATGCGACGCGGGTGGCTAATAAAGTCATTAAATCGGATATGCAGG
TCAAGATGTACGGGCTGCCAAATACAAAGGGGTTTGCCTGCCATAAACTG
AGCTTGGACTCCAAGGGGAAGGGTATTGTGCTGGAGCAGTTGGCGGATGT
TGGAAATCACGTTGCGGAGGGTCTGGACATAGTGAATGGGGGAATGGGCG
TTGCTGAGAAGCTGGGTGGGGCAATGAGGAGCGTTCGTGCTGCGAGAGAT
GCATTGAGAGGGACCCAGGCGCATCGATTGTTTCCCTACCACGCCATGGA
TCACAGAGTAAGTTCACCCGAGATCTATTCTGCGATTTGGTTTACGGCAG
GCTGATTGCTCAGATATTTG

Sequences in the Contig:

SY0AAA53YH12FM1