Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YG18FM1
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00004651001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05110
Accession: ref|XP_001593682.1| Score: 637 E_value: 8e-65
KEGG Definition: hypothetical protein ( (AL442164) conserved hypothetical protein [Neurospora crassa OR74A] )
Accession: ncr:NCU02032.1 Score: 579 E_value: 2e-58
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_76, Glycosyl hydrolase family 76. Family of alpha-1,6-mannanases..
Pfam Number: pfam03663 Score: 525 E_value: 2e-54
Swissprot: P36091|DCW1_YEAST
Gene Ontology:
GO:0046658 = Cellular component: anchored to plasma membrane
GO:0005624 = Cellular component: membrane fraction
GO:0007117 = Biological process: budding cell bud growth
GO:0009272 = Biological process: fungal-type cell wall biogenesis

Sequence:
>SY0AAA53YG18FM1
TTGGTCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGAC
TAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACG
AAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCAATG
GCAACCCTACGCCGCCTATCTACATCGCTGCTATTACTATCGCCCCTAAT
TGCTGCCTATGAACTCGACCTTGATAATAAAAAGTCAATTCTCGACATAT
CGCGAAATATCGCCTACAAGATGATGACCTTCTACCCCGGGAATAAGACG
GGGGGGATTCCGGGTCTTTTTGGTGACCCTTACTACTGGTGGGAATCGGG
TGCAGCATTTGGTTCGTTGATAGATTACTGGTACTATACGGGTGATGAGG
GATATGTCAATGTTACTACAGAGGCGATGTTGCATCAGGTTGGACCTGAC
CAGAATTATATGCCACCGAATCAGTCGAAGTCACTTGGAAATGATGACCA
AGGATTTTGGGCCTTATCAGCGATGTCTGCCGCTGAGAAGAACTTTCCCA
ATCCCCCAGATGGCCAACCTCAGTGGCTTGCGCTATCACAAGCTGTTTTC
AACTCGCAAGCGGCACGTTGGGATACACTGAAGTGTGGTGGGGGTTTACG
TTGGCAAATTTTCACATTCAATGATGGCTATGTC

Sequences in the Contig:

SY0AAA53YG18FM1