Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YF14FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00008828001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001540913.1| Score: 317 E_value: 8e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04429 Score: 298 E_value: 7e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9UT23|MFH1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0043140 = Molecular function: ATP-dependent 3'-5' DNA helicase activity

Sequence:
>SY0AAA53YF14FM1
TTGGGGGAAGAACAGGTCGTAAACGGGATGGTCACGTCCATATCCTCCTC
ACCCAGGGCAAGGAAGAAGATAATTTCAAAAGGGCAACGAGGGATCACGA
ATTCATTCAAGGCGAGATTGAGTCCGGAAAACGATTCAACTACCATCATG
ATTTATCACCACGTATTGTACCGAGGGATATTGAGTGTGTGGTTGATAGA
AAGGTCATTGAGATACCTGCCGAGAATACCCAACCCGAGCCTCCAAAGCG
GAAGTTAAAAGGGAAGGGGAAGCAGACTAAGGTTACAAAAAAGTTTCTCA
TGCCCGATGGGGTCAAAACCGGCTTCGTGAGGGCGTCTAGGATAGGAAAG
GAGTCTGATCAGGAGGATGAGGAAGATGATACACCTGTTGAGAAGGAGTC
TCCAGCGCCGGACATCCTTGATCCGGAAACCGGCCTATTGACCAGAAGCG
AAGAGAAGAAGCTCCAAAGAACATACCAAACAGACTGGAGCGGCGTCGAC
GACGGAGTCCTGGTTGTCAACCCACCTCGAGCGGACGCATTCCCGGGGCG
CCAGAGAACTCTCACGAAAACTCACCATGTCCAACACGGTCGCGCCACTA
TATCCACGGCGAGAGCTTTA

Sequences in the Contig:

SY0AAA53YF14FM1