Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YE08FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00010058001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09698
Accession: ref|XP_001799984.1| Score: 375 E_value: 2e-34
KEGG Definition: predicted protein
Accession: aor:AO090020000195 Score: 368 E_value: 7e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA53YE08FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGTTTGCTAGCCACATGAC
TACTCTGATATCGATTCTGGCTTTGGTGCCTCTATCGCGAGGACTGAGAA
CAGCTATTCTATGATAGCGGGCTCGGGAATCCATCCCTACGTTTACGAAA
ATGGACGTCGCTACCAGGTTTATCGTGAAGGGGTATATATGCTGCCCAAC
GACGCTCAGGAAATTGAGAGATTGGATCACTTTCATCGCATATTTCTCGC
CTTGTTGGATGGAAAGCTTTTTATTGCCCCGCTCGGACAAGACGGGCATA
GAGTGAGGAACGTATTGGATATCGGGACGGGAACGGGGACCTGGGCAATT
GAGATGGCCGAAGAGTTTCCGGACGCCAAAGTGATGGGGAATGACCTGAG
CAAGATACAACCATCATGGTAGATCTATAGTTTCCATTTTGTCCTGCGCC
ATCACCCGACATCACCCGTATTAGCTAGAGAGACAATCGGGGTGACTATT
TTGTCTGGAATGAGGGCAGACGCTAACATGATCCCGCCTGGTTTGCATGG
GAGGAATTTGTGTAGGGCCCCTAGGAACTGTGAATTCGAAATCGACGATG
TCGAAAGTGACTGGACATATCCCGAAAACCACTTTGACTTCATCCACCTT
CGAAGCTTAAGCGGGTGCTTTCAAGACTGGGACATGGTGATAAGGAGATG
TTAC

Sequences in the Contig:

SY0AAA53YE08FM1