Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YE02FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00009712001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: myosin II regulatory light chain (PMID 11056543)
Accession: ref|NP_594364.1| Score: 218 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: spo:SPAC926.03 Score: 218 E_value: 1e-16
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0031 Score: 257 E_value: 2e-23
PFAM Definition: No Hit Found
Swissprot: Q9UUG5|MLR1_SCHPO
Gene Ontology:
GO:0005826 = Cellular component: contractile ring
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0017022 = Molecular function: myosin binding
GO:0000915 = Biological process: cytokinesis, contractile ring formation

Sequence:
>SY0AAA53YE02FM1
TTGGCGGTGATGGAATTATTGGCAAGCAAGATCTTGGAGCTATGCTTGGG
AGCCTCGGTCAAGACCCAACTCCAGCGGTGATCAATGCGCACTTGTCTTC
CGTCCCCACACCCTTCAATTTGGCCTCTTACCTCACTCACCTATCACAAC
ATCTGTCCCTGCTTACCCCTGGACCCGACCTCCTAAGCGCGTTTGCGGCG
TTTGACGATAACGACGATGGCACAATTGATGTTGCAGAACTTGCGGAAGC
GTTGACAAGCATGGGTGAGAGAATGAGCGAGGCAGACATTGAGCGGGCGT
TGAAAGGGTTCACGAAGAGGAGAGCCTTGGGAAGAGGGCAGACTCACGGT
GGAGATGTATTCAGGTACAGGGACTTTGTGGATGTGCTCTCCGGGAAGGA
AGAGGAGAAGGAGTAATGCATTTTTTGTGTGTGGTGCCGGTATTGGGGTA
GGGTGGGAGCTATTGGAATTGGTACTGCTTTTACGATTGTTGGGGAATTT
TTTGGTTTTGGGGTGCGTAACGACTGTATTATATCCTTAGGCTCAATACA
TTTCGAATAGGGAATTGATGATC

Sequences in the Contig:

SY0AAA53YE02FM1