Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YC02FM1
Length(NT) : 204
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 102 E_value: 6e-06
PFAM Definition: zf-CSL, CSL zinc finger. This is a zinc binding motif which contains four cysteine residues which chelate zinc. This domain is often found associated with a pfam00226 domain. This domain is named after the conserved motif of the final cysteine..
Pfam Number: pfam05207 Score: 120 E_value: 6e-08

Sequence:
>SY0AAA53YC02FM1
TTGGATGATGAGGTGTTTAGGGGGGAGGAGCAGCAGCAGGGGGGGTGGAA
GGGGGTTTGGTGGAGGGGATGTAGGTGTGGCGAGGAGAGGGGGTTTGTGC
TTACTGAGGAGGATTTGGAGGATGGTGAGGGGATGGGGGAAGGGGATGGA
GGGGAGGTGGTGGTTGGGTGTGTTGGATGTAGTCTTTGGGTGAGGGTTGT
TTAT

Sequences in the Contig:

SY0AAA53YC02FM1