Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YB17FM1
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00011459001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 442 E_value: 3e-42
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 416 E_value: 2e-39
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 243 E_value: 1e-21
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAA53YB17FM1
TTGGTAAAAATGCTGCTCAGGCGGGGTGATGTCAACCCTGACAAACCAGA
TGATAAGGGTCAAACACCCCTCTGGGGTGCTGCCTGGAATGGTCACGATC
GGGTGGTGAAAATGCTACTCGGGCGAGGCGACGTCAACCCCAACAAGCCA
AGTGACTACGGCGAAACACCACTGTGGGGCGCTTCTTTGAATGGACACGA
GAGAGTGGTGAAAATACTGCTCGGACGCAGTGGTGTCAACTCCAGCAAAC
CAGATTTCTACGTAACACCACTCTGCCGCGCTGCTTGCAGCGGGCACACA
GGAGTGGTGAAAATGATACTTGAACGGGACAACGTCAATCCCGACACACC
AAATAGGTGTGGGCGAACACCAATCTTGCTTGCTGCTGCCCAGGGCCATG
AGGCGGTGGTGGAGATGCTATTCAATCGTGGTGGCGTTAACCCTGACATA
CCCGATGACAATGGCCGAACGCCGCTCAGTTGGGCTGCTGGGAATGGACA
CGAGGGAGTTGTAAAAATACTACTCGGACGGGAAAACATCAACCAGGACA
AACCCGATAATGGTGGCCGAACACCACGCAGCTGGGCTGCTAGATTTTGG
CGGGTGGGTATCATAGCACTATTCCAGCTCCTAGCACCCCCGCCCCCGGC
ACGGCATAAGG

Sequences in the Contig:

SY0AAA53YB17FM1