Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA53YA18FM1
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00004837001 E-value : 1e-144
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503937.1| Score: 396 E_value: 6e-37
KEGG Definition: hypothetical protein
Accession: yli:YALI0E14322g Score: 396 E_value: 3e-37
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 153 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: P32573|SPS19_YEAST
Gene Ontology:
GO:0005782 = Cellular component: peroxisomal matrix
GO:0008670 = Molecular function: 2,4-dienoyl-CoA reductase (NADPH) activity
GO:0009062 = Biological process: fatty acid catabolic process
GO:0030437 = Biological process: ascospore formation

Sequence:
>SY0AAA53YA18FM1
TTGGATCAAGAAACACATGTCCCCGATATGGGCGCCAGGGATCTTCGGTA
TGTCAAGACACCATACACTGCGCTTTCCCGTTCTCTTCACTGAAACCTGA
CCTACCAACTCAACTCAAACAGAAGGCAAAGTGGTCCTCTGCACCGGTGG
AGCCGGCTCAATTTGCTCTACGCAAGTAGCAGCACTAATCCTACTCGGCG
CGAACGCCAGCATCATCGGACGGAGGAAGGACGTGACGGAAGCCAAAGCC
GCAGAACTCCAAACACTCCGAAGCGGTAGCAAAGTCCTCGGTATATCCAC
CGACGTGCGGGACTACTCGGCACTCGTCACGACGGTGAAGCGGACGGTTG
AGGAATTGGGGAGGTTGGACTATGTCATGTACGATTGTTCCCCATGGCAC
TTTCTTTGTCCGAAGAAGGAAACAGCAGACAGTTAACAGGGCGAATGGGA
TAATAGCTGTGGAGCAGCCGGCAATTTCCTGGCAACGGTTGACAACCTAT
CCGTCAACGCGTTCAAGTCTGTTATCGACATCGACGTTCTGGGTTCGTAC
AATACGGTGAAGGCATCACTGGAGGAACTCAAGAAGACCCGCGGCAAGAT
CATATTCGTCTCGG

Sequences in the Contig:

SY0AAA53YA18FM1