Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YM24FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00007611001 E-value : 1e-164
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_10632
Accession: ref|XP_001800895.1| Score: 157 E_value: 9e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG10036.1 Score: 146 E_value: 2e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA52YM24FM1
TTGGCGCTATCGGTAGAACCAAAGAGGAAAAAAAGGAGAAGCTCCAAAAA
TAATGGCTTCAAGATGCATTCTCTCAACCGGAAATGTCATGACCGCTGGC
GCGCAGGTTATCCGCAAACCGACCCTCGAAAAGTCAAACACGGAGTTGGT
TAACTCTTTGCGCGAAAACTTCAAAGAGGCCTCCTCCACACTCCCGCTTA
GCACAAACCCAAACATCGCAGCGACAAGCAACCCGGAAACAAGGCTGGCA
CCGGAAGAGTGGACAAAATTAGGGTCAGATGGGGTCCTGTACGTTCCTAC
AGAAAGTGGTGAGCCGCACGGACTAGCAGAAGATAGAGAAGATAAAATTA
TTCTACCTCCCGGGAGTCCCGTCCTCTTCTCGCTGCAGGCACACCGAAGA
GGCCGTACGTCTAGTTTGCAAGGAGCTCGGAATATCCTCTATTGACCTAT
TGATCGTTTCCTTCCCCAACATCTCCTTTGACGCCGAAGACGAAGACATA
TCCTCGGAGGAAGACGTCAGCGAATGGGTTCGCACATATCGTACT

Sequences in the Contig:

SY0AAA52YM24FM1