Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YM07FM1
Length(NT) : 675
Best Gene Model Blast : Link to GSTUMT00007088001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55410.1| Score: 263 E_value: 2e-21
KEGG Definition: predicted protein
Accession: aor:AO090005000336 Score: 263 E_value: 9e-22
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 126 E_value: 4e-08
Swissprot: P39720|OAF1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003677 = Molecular function: DNA binding
GO:0005515 = Molecular function: protein binding
GO:0016563 = Molecular function: transcription activator activity
GO:0006631 = Biological process: fatty acid metabolic process
GO:0016481 = Biological process: negative regulation of transcription
GO:0007031 = Biological process: peroxisome organization and biogenesis
GO:0045941 = Biological process: positive regulation of transcription
GO:0034201 = Biological process: response to oleate

Sequence:
>SY0AAA52YM07FM1
TTGGCCGTCGACCGGTGCTTCAACGTCAACAACGCCCACTCCTACTGCTG
GCACCACCACCGCCACCACCACCGTTGTTGCTAACAAGACAGTTAGTGGA
GCCACTGGTACAGGTGTTAAACGCGCGCATGCTTCGTCCAATGCCATCTC
GAATAAATCTAGGTCTGCGGCGAATTACCCGAGGAAGAGGGCTGTGAGCG
CGTGTCTGGTTTGTCGGGGGAGGAAGACGAAATGCGATAACCAGCGGCCG
CAATGTGGATTTTGTAAGCAGACGGGGGCGGAATGTGTTTACGAGGCGGA
AAAGTTGGCTACATTCGACGCCGCCTCATTGGCGATTCTGGATAAGCTCT
CCAGGATAGAAGCAATGCTGGATTCAGACCGGGGCTCAAGCAATCAGCAG
CACACGCCTACCAGTCACCCTTCCCCACACACCTCGGGTTCCACAACCAG
CGGCGGCGCCGTGCAAATACCTTCCCTACCACCGCTCACCGCACGCGGTA
GCTCGCCGAAGAGCGTGGGGAGCAAACCGCCCCCAGATGCCTCCGAGATA
TTCCCCGTCTCCGTCGCTACAGCCTCGGGATCCCGTGTCGAGGACCTCCT
CCAATGGCCAATATTCAACGGACAATTCTGCGTGGAGGAGATCCTTGCAC
CAGTATTTGCGGATTCCCACGGTGA

Sequences in the Contig:

SY0AAA52YM07FM1