Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YK24FM1
Length(NT) : 614
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_10261
Accession: ref|XP_001239239.1| Score: 245 E_value: 2e-19
KEGG Definition: hypothetical protein
Accession: afm:AFUA_1G09720 Score: 212 E_value: 6e-16
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 115 E_value: 7e-07
PFAM Definition: Mod_r, Modifier of rudimentary (Mod(r)) protein. This family represents a conserved region approximately 150 residues long within a number of eukaryotic proteins that show homology with Drosophila melanogaster Modifier of rudimentary (Mod(r)) proteins. The N-terminal half of Mod(r) proteins is acidic, whereas the C-terminal half is basic, and both of these regions are represented in this family. Members of this family include the Vps37 subunit of the endosomal sorting complex ESCRT-I, a complex involved in recruiting transport machinery for protein sorting at the multivesicular body (MVB). The yeast ESCRT-I complex consists of three proteins (Vps23, Vps28 and Vps37). The mammalian homologue of Vps37 interacts with Tsg101 (Pfam: PF05743) through its mod(r) domain and its function is essential for lysosomal sorting of EGF receptors..
Pfam Number: pfam07200 Score: 122 E_value: 9e-08

Sequence:
>SY0AAA52YK24FM1
TTGGGAGCAACCAATGTCGACGCCATCGTCATACCAGAGTAGCGCGTCTT
ACGATCCAAACCTTCCACCAGCCCCGCCGCCAAAGCCTATATCCTCGGCT
GCGGGGTCCCGAACTACTTCGCCTATGCCCGCGGGAGCTCTTTCTGCGCC
CCCACCGCCCCCACCACCTCCGACAGACGACGGTTTCGTCCCGTCTGTGT
TGCTGAACAAATCACGCGATGACTTAGAACACATCCTCAACTCCCCGCAA
TTACTAGAAGCACTCTTCGCGGCTACCCATCCTATGGCGGCGAGTGCTGA
TGCGACGCTCATTGCGAATTTGCAGCACAACGCGGAGTTAGCTGCTCGAC
TCGCCGCGCTCGAGTCCAAACTTGTAACGGCCAGGGAGAGCGCAGAAAGG
ACGCTTGTAGAGACCAGGCAGTTGGAAAGGACTTGGAGGGATAGGGAGAA
GGAGATGTACCAGGCTTTGCAGCCGTTCTCTTCTCCTGCATTGTACAGTC
GATTGGTTAATGCTGTGGGCGATGCCGAGGCTGTTGCCGATGCCATGGCA
GAGTCGTTTTTAGAGGAGGGTGGGAGGGATGTTGGTGAGTTTGTGAGGGA
GTATAGGGCGCTGA

Sequences in the Contig:

SY0AAA52YK24FM1