Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YK11FM1
Length(NT) : 564
Best Gene Model Blast : Link to GSTUMT00005330001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_08251
Accession: ref|XP_001225907.1| Score: 441 E_value: 3e-42
KEGG Definition: hypothetical protein
Accession: ncr:NCU03575.1 Score: 439 E_value: 2e-42
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0434 Score: 327 E_value: 1e-31
PFAM Definition: No Hit Found
Swissprot: O13651|SYIC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006428 = Biological process: isoleucyl-tRNA aminoacylation

Sequence:
>SY0AAA52YK11FM1
TCCATTACCAGCGCGGAGGTCAAGGGGTTTGTCCAAGAAAAGAAGATTGT
TGTTGGGGGCATCACACTTATCGAGGAGGACCTCGTCGTCAGTCGTGGCC
TCAGCGGCTCCGACACATCTCAGGACTTCGAAACAAACACCGACAACGAC
GTCCTCACCATCCTGGACACAGTCCTCCACAAAGACCTCCGGAATGAAGG
CCTTGCCAGAGAGATTGTCAACCGTGTACAGAGACTTAGGAAGAAGGCTG
GCCTCCTTCCAACCGATGACATCAAGATGGAGTACAAGGTCCTTCAAGAC
CCGATCGGGCTAGAAGAGGTGTTCCTCGAGCACGCCGACACTTTTGAGAA
AGCTCTTCGCAGACCCCTGGATAAGGCTACCATCACCCAAGTTGGCGAGG
TCCAACCCGGGGAGAATCTAGATAAGATGATTCTGGAGGAAACTCAGGAG
GTCGGGGAGGCTACCTTCATGCTTAGGTTGCTTAAGCTTTAGTTGCGCTG
TGTGGGGCTGCTTGCACGAGGCACTTTTCTTTTACTTGTTTACTCTTTTA
CCCATTCTTCTATA

Sequences in the Contig:

SY0AAA52YK11FM1