Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YK02FM1
Length(NT) : 652
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g03220
Accession: ref|XP_001394324.1| Score: 150 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ang:An11g03220 Score: 150 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA52YK02FM1
TTGGATCCCCCTGTCAATTCTGCGAAAAAAGCAATCGTCGGTGCATATAC
GAAGCTCGACCAACCCGAATCCCCCTCACCCGCCAAAACCTCGACAAACT
CCAACTCCGCTGTGCAAAGCTCGAGCATCTCCTCCGCACCATAGACCCTA
ATGTGGATGTCGAACGCTCCCTATCCACAGACCGGTATACGGCCACGGGC
TCGACCACAACAGAGCACAACAACGCAATGCGTGTGATGGAGTTTTACTA
TCAGGACATGCGCAGGTGCGATGACGAGGAGGAGGAGGCGCCGCCAGAGA
GTGCGTGTGGCTTTGAGTGGCGGGAGAGCGAGGGTGATGAGCTCCCTGGC
AGGGCCGGCAGCGGGGGAGGGGATGCGACGGTGGTGGGGCTGTCGGATGG
GATGGCTTCACTGAATGTTGATGCTAGGGATGTTGGATATCTTGCTTGAT
TTTAGGTACGTCTTCCGGAGCAGCATTACTACGGACAATTCAACGCCTCG
TCACTCGATATTACCAGGGCTCGCTATTACCAGAGTCTATTCCTACCTCC
CCACCTCCGAGCGTCGATATTGCCCATAGGCTCAATTCTTCGTTTGCTCG
GCAGTCTCTTGTGGATTCATATTTTTACTTGTACCATCCCTCCTACCCCC
TG

Sequences in the Contig:

SY0AAA52YK02FM1