Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YJ18FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00002451001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: glutamate synthase
Accession: emb|CAJ20840.1| Score: 931 E_value: 6e-99
KEGG Definition: hypothetical protein
Accession: fgr:FG01433.1 Score: 930 E_value: 4e-99
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0399 Score: 907 E_value: 1e-98
PFAM Definition: GATase_2, Glutamine amidotransferases class-II..
Pfam Number: pfam00310 Score: 416 E_value: 8e-42
Swissprot: Q9C102|GLT1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAA52YJ18FM1
TTGGCCCAGCCCCTACGGTGGGTAGCTCACAATGGTGAGATTAACACGCT
GCGTGGTAACAAAAATTGGATGCGAGCACGTGAAGGCCAGATGAAATCTG
CTAAGTTTGGAGAAGAGCTGGAGCAGTTATACCCCATCATCGAGGAGGGG
GGGTCCGATTCTGCGGCGTTTGATAACGTTCTTGAGCTGCTTACTATAAA
TGGTGTCCTTTCCCTACCGGAGACCATTATGATGATGGTTCCCGAAGCCT
GGCAAGATAATGCTCTGATGGACCCCAAGAAAGTGGCCTTCTATGAATGG
GCTGCCTGCTTGATGGAGCCTTGGGACGGCCCAGCATTGTTTACTTTCGC
GGATGGGAGATACTGTGGTGCTACATTGGATCGTAACGGCTTAAGGCCAT
GTAGATTCTACGTAACGGATGACGACCGCATTATTTGTGCATCCGAAGTC
GGCACTATCTTGATCGATCCAGAGCACATTATCCAGAAGGGTAGATTGAA
GCCTGGGAGGATGCTTTTAGTAGATACTGTGGAAGGGCGGATAGTTGATG
ATAAGGAGCTGAAGATGGGGGTGTCTTCTCGGTTCGATTTCACTTCATGG
GTCGAAGAACAATTACTCACCATTAAGAAAGTATATAACC

Sequences in the Contig:

SY0AAA52YJ18FM1