Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YI21FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00002261001 E-value : 1e-123
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61056.1| Score: 141 E_value: 2e-07
KEGG Definition: predicted protein
Accession: aor:AO090012000957 Score: 141 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA52YI21FM1
TTGGCGACTTCCTCATGTTAGAACCGGTCTTGCATGGGTTGTCATCAATC
TCACCTGGCGCGAAGAACATGAAGATATCGAAGAGGTTCACGCTCGAGCT
AGGGAGCTAATTAGGCTAGGGTTTGATAAGAGCTTAGAAAGCATGTCTCA
GGATTCCGAGCTGGACGTCAGAGAGAGAGTTAAGACTGCCAGACATCAGT
TGAGCACTGTTGGGCCTGCGGATTAACTGTTGCCACTACCTACCTACAAT
TCGAACCGCAAGGATCTGTGTATTACTACTGGGCTCTGGGTCTCTTTGTC
TTTCTACTCTTTATACCAATCACCTGTTTTTCTTCCCCCCTCCTGTTATC
TAACAGAGGGATAGGGGTGAAGTACACAGGTGAGGTTGCTTTTCTCTTTT
TTCTAATACTTTTTTTTTTTCTTCTGCGAATTTTCATGCCTTTGATTTTC
GAAGGGTTCATTTATCGCAGTGCCATGCGGGGGGGGACGTGGAAAAAAAT
CTTTACTGCGGGCTATTTGGTTGGCTATGGGCTCTTTTCCTATGTTAGCT
ACCGGTAAGGGGTCATTGGTTGGTTTAAGGGGGTTTCGCAATTTTCATTC
GGAATTGAAAAAAGTGGGTACTTTTTTT

Sequences in the Contig:

SY0AAA52YI21FM1