Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YI02FM1
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00010823001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG10105.1
Accession: ref|XP_390281.1| Score: 181 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG10105.1 Score: 181 E_value: 3e-12
KOG Definition: No Hit Found
PFAM Definition: SPRY, SPRY domain. SPRY Domain is named from SPla and the RYanodine Receptor. Domain of unknown function. Distant homologues are domains in butyrophilin/marenostrin/pyrin homologues..
Pfam Number: pfam00622 Score: 162 E_value: 2e-12
Swissprot: O94712|YC5C_SCHPO

Sequence:
>SY0AAA52YI02FM1
TTGGGACCGGGGGGGTGGGAGGCTATCGATAATTCAACAGGGCTGAAGAT
TAGTGAAGATGGATGTGAAGTTGAGAATCTCTCGGCCACTGACGAGCAAC
TCCGGGCAAAATTCCCTATAACTCCGGTCCTGGACAACTACTACTTCGAG
GTTCACATCTTGAATAGATCATCGAATGGCTGCCAAATTGGCTTCGTGGA
TGCCATGTACCACTACGTCAGCGACGGTTTCGAGCTCTACAATTCTTTCC
CTGGACAAATGCTCCGTTCCTGGGCCTACGCCTCAGGGCGCATCTACGCA
GAAGAGGATTGTCACACGAAATCCGTTCCTGATTTTACCACCAACGACAT
CATAGGCTGCCATTTCGACCGGGTGCGAGGCGCAGTCTCATTCACGCTGA
ATGGAAAACGAGCTGGTCAACCACTGCCCGGGATCCGCGGAAAATTACGT
CCAATTGCCAGACTCGCGCCTGGGGATAAAATTCGAACTAATTTCGGCAG
CGCACCTTTTGTACACGATATCCCCGAACCGGCTACTCCGGAGGCCTACA
TCAAGCAGGGATCGGCTGCTCGTTGCGTAACGTTCTGGTTTGGCCATCCT
GATGAGACCGCCGAGTGATGCTTTGTGTCTAACATTTGTGGCTTGTTGTG
CGATGTTTGGGCTGAGCATGTA

Sequences in the Contig:

SY0AAA52YI02FM1