Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YH17FM1
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00004441001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08383
Accession: ref|XP_001798698.1| Score: 361 E_value: 6e-33
KEGG Definition: hypothetical protein
Accession: ang:An02g02510 Score: 355 E_value: 1e-32
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0970 Score: 185 E_value: 4e-15
PFAM Definition: No Hit Found
Swissprot: P28040|DPOA_SCHPO
Gene Ontology:
GO:0005658 = Cellular component: alpha DNA polymerase:primase complex
GO:0003889 = Molecular function: alpha DNA polymerase activity
GO:0005515 = Molecular function: protein binding
GO:0000076 = Biological process: DNA replication checkpoint
GO:0000734 = Biological process: gene conversion at mating-type locus, DNA repair synthesis
GO:0000723 = Biological process: telomere maintenance

Sequence:
>SY0AAA52YH17FM1
TTGGATCTTCTCCAATCGCGGATGCCGTCAAGAGGAAGCGCTCGAAAGAT
GAGGACGAAGATGATGAAGATCTTTCTGTTGCGCGGATTCAAGGTAGCAA
ATCTATCAAGGTGGAAGCTGTCAACATCATTGCTTCGAGGCCGGCACTCA
AGAGTCAAACTGTGAAACAAGAGGCAGTTGTACCCAACAAACCAGTCGCA
GCGATTGATCCTACAACCTGGGCATCGTTTGCCGGAGGGGACAATGTCAC
GAGCTCTCCTGCTTTAGATGGTTCTGACCTTGAAAAGCTGGGGCCCGAGG
ACGTTGAGGAAGATGGGTTCATTAAAATGTTCTGGTTAGACTATACTGAG
GTTCATGGGAGCCTTTGTCTTTTTGGGAAAGTTCAAGACAAAAAGTCGGG
GAAGTATGTCAGTGCATTCCTAAAAATTGATGGAATACTCAGAAATCTAT
ACTTTTTGCCAAGGGAAACAAGATACAAGAATAAATTGGACACTGGTGAG
ATCGTAGCAATGCAAGATGTCCATGATGAGATCGCAGAAATCATGGAACA
CCATGGAATCAATTTTTTTAAGGCTAA

Sequences in the Contig:

SY0AAA52YH17FM1