Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YH05FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00011839001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_11897
Accession: ref|XP_001802133.1| Score: 385 E_value: 9e-36
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00984 Score: 318 E_value: 3e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA52YH05FM1
TTGGTGCAATTCTTGCGAGACTAGTATCAAGGATGTGCATTATCACTGCG
GATGCTGCGATGGGGGAGATTATGACCTCTGTAAGGGCTGTGTGGCTCGT
GGGATTCACTGCAAAGACTCTTCTCATTGGTTGATCAAGCGTGTGCTTTC
CCCCACGGGGGTTATCGTTTCCAGCACGACCGAGTCTGTGTCTCAGAAGG
ATGGATCTGTGCAAACCTCTTCCCGCCGTACTTGCAACTGCTGCGTTGTT
GGTGAGTTTTATCCCTGGGATTTGGCTTTTTTACGAGATACTGGTTACTA
AATCTCTATTACAGACTTACCTAGCAAGGAGTTCGTCACATGTAAGGTGT
GCGAAGACTATGATGTTTGCATTTCGTGTCACACTTCACTCAAGCACGGC
CACAACCCAAGCCATGAGTTTGTGCCGGCTGCTCCAGATACCATGCTTCA
ACCATATGCAATCTCTCTTCTTGCTCCTGGTCGAGCCCACCGTCACTATG
CCGTTTGCGATGGCTGTGATAAGCAAATTTATGGAGTGAGAAATAAATGT
TTGAGCTGCCCCGAC

Sequences in the Contig:

SY0AAA52YH05FM1