Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YG02FM1
Length(NT) : 527
Best Gene Model Blast : Link to GSTUMT00007057001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: cation transporter, putative
Accession: ref|XP_001261209.1| Score: 315 E_value: 9e-28
KEGG Definition: hypothetical protein
Accession: yli:YALI0B17864g Score: 307 E_value: 4e-27
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1341 Score: 308 E_value: 2e-29
PFAM Definition: TrkH, Cation transport protein. This family consists of various cation transport proteins (Trk) and V-type sodium ATP synthase subunit J or translocating ATPase J EC:3.6.1.34. These proteins are involved in active sodium up-take utilising ATP in the process. TrkH a member of the family from E. coli is a hydrophobic membrane protein and determines the specificity and kinetics of cation transport by the TrK system in E. coli..
Pfam Number: pfam02386 Score: 212 E_value: 3e-18
Swissprot: P28584|TRK2_YEAST
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0015079 = Molecular function: potassium ion transmembrane transporter activity
GO:0030007 = Biological process: cellular potassium ion homeostasis

Sequence:
>SY0AAA52YG02FM1
TTGGGTTCCTGATATGTGTTGCCGAGGGGAGAAGGATTGCGGATGCGAGT
GATTACGCGTTCACAGCATTCAGTGTATTTTTCGAGGTCGTTAGCGCTTA
TGGAGACGTCGGTCTATCACTCGGCTACCCGGGCCTCAACACCTCCCTCT
CCGGAACCTTCACCACATTCAGTAAACTCGTCATCGTGGCAATGGAGATC
CGCGGCCGGCATAGAGGTCTCCCGTACGATGTCGATCGCGCAGTGTTATT
GCCTAACGTAACGACGCCGGATTCGATGTTTGCGCCGGATGGTGCCAGGT
TGGAGGGGGTGAAGAGCAGAAATGGTGAGAAGGATGAGGAGATTTAGTGT
GGGGGTATTACGGGTAGGTGGGGTTATGGGACGGCGGATGGGTTTGTTGT
ATGTTGTGCTGTGTTTTTGGATGGTAGAATTAGATGGGATGGAATGGGTT
GTGTGCGGATCGTATAGCTTAGCGCTGCGTTGTGGAGAGGGGAGGATATA
TCTGATGGATTGTTAGGACGTTTCTGA

Sequences in the Contig:

SY0AAA52YG02FM1