Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA52YF14FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00009235001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG04602.1
Accession: ref|XP_384778.1| Score: 392 E_value: 2e-36
KEGG Definition: hypothetical protein
Accession: fgr:FG04602.1 Score: 392 E_value: 8e-37
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA52YF14FM1
TTGGCAAGGGACAGAGGGAATTATGGTTATTCGCCATTCTGGGCTTGACG
CTTCAGTTTGGCTCCCTGGTCTTCATTGGGGTCGCCCGTTATCACCACAA
GCTCAATTTGAGGGAGGACGAAAATTCGAAATACGCCTACCCTCTTATGG
CAGCCGGGACTCTGTTGTTGGTAATGGGGATGATGGCATGTTCGCATGTA
GTGCAAGCATCATCTGTAGAAACCACCTGGGTGGCTGAAAAAAAATTTAA
GATTCTATGGCTGCAGAAGAGCGCTACTGTCAACGATCAGTTATTCGGGT
CATATGCCCTATTTGCGGATGAGGAACGCAACAAACTTACCACTTCCCGT
CGTAGAACATACATACCTTCCTCAAAACCTTCAAGTCCTTCAAAGTACGC
CTTTGCTGCGGCTCTCTCCTTCCAGAATCTGACGATTGTGGGGTCATTCA
TCAGTCTTGTTGGCTTCGTAACCCAGTTTGTCGGAATTCGTGCTCTGCAT
TGGTCAGCGTCTATTGCACAGCTGGTCGTAACTTTAGCGATGACTGCTGT
GAGAACTTGGATTCGTCGAAATATGTCTGCGCGGCCGGGGGCCAAAATCC
TGCCGACTGATTATGA

Sequences in the Contig:

SY0AAA52YF14FM1