Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA4YA19FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP-dependent molecular chaperone HSC82
Accession: ref|XP_001540846.1| Score: 763 E_value: 2e-79
KEGG Definition: molecular chaperone and allergen Mod-E/Hsp90/Hsp1; K04079 molecular chaperone HtpG
Accession: afm:AFUA_5G04170 Score: 748 E_value: 4e-78
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 728 E_value: 5e-78
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 900 E_value: 7e-98
Swissprot: P40292|HSP90_ASPFU

Sequence:
>SY0AAA4YA19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGCGCCATCCTTTTTGTCCCCAAGCGTGCTCCCTTCGACTTG
TTCGAGACCAACCGCTCCAAAAACAACATTAAGCTCTACGTCCGCCGTGT
ATTCATTACTGACGACTGTACTGATTTGATTCCGGAATGGCTTGGTTTCA
TCAAGGGGGTTGTCGATTCTGAGGATCTCCCACTTAACTTGTCTCGTGAG
ACTCTCCAACAGAACAAGATCTTGAAAGTTATCAAGAAAAACATTGTCAA
GAAAACTCTTGAGATGTTCAACGAGATCTCCGAGGACCGTGAGCAGTTCG
ACAAGTTTTACAGTGCCTTTAGCAAGAACATTAAGCTTGGCATTCATGAG
GATGCCCAAAATCGTCCTGCCCTTGCCAAGCTTCTCCGCTTCAACTCTAC
TAAGAGCGGGGACGACGCCACATCTTTGACTGACTACGTTACCCGCATGC
CCGAGCACCAAAAGCAGATGTACTACATCACTGGTGAGTCTTTGAAGGCA
GTTTCCAAGTCTCCCTTCTTGGACGCTCTCAAAGCCAAGGACTTCGAGGT
TCTTTT

Sequences in the Contig:

SY0AAA4YA19FM1