Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA46YO17FM1
Length(NT) : 469
Best Gene Model Blast : Link to GSTUMT00010734001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001259526.1| Score: 314 E_value: 9e-28
KEGG Definition: dual specificity phosphatase
Accession: aor:AO090120000287 Score: 295 E_value: 7e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA46YO17FM1
TTGGGTTCAGAGCCCATTCTCCATGTTTGAGAATTACTTTCCGGAAATTG
TTACCATAGACTCGGCAGGTAATTTGACGGGAAAAGTGATTGATTTTTGT
CACTGGGAAAGAATGGAAATGTGCTCCATGTCCAGGGCAACAGAGATCTC
AAAAAATGTCTGGCTAGGGTCCAGCGCCGACACTGCACCCGAGCCGGAGC
ATGAGCCGCCGTATGGTTTGTTGATCGAGGCTAGTGACTTGGCTCAATTG
CCGTCAATTGACAGCCTTCGAGATCTGGGTGAGATCATGGACCGTACGGA
TGCGACCCAATGCATTGAATTTCCCGGTTCGGGTACAATGACACCGCCGA
GGTATACGGCTACAGAAGTTGACGGCATTATCGATACTTGCCGCTTCATA
CAATCCGTTGCAAATGGCGGGCATCAAGAGGCTCACGATGCTGATGGTGA
TCTCTCGATGACGCCACCT

Sequences in the Contig:

SY0AAA46YO17FM1