Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA45YI05FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00007910001 E-value : 9e-67
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 107 E_value: 1e-06
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 107 E_value: 5e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA45YI05FM1
TTGGGAAAGAGCATCTCTTAAGTGATCCGACCTTATTCCATAGCCCCCAC
TCCACAATTGCAGAGGTTTGCTTGACATACCTCAATTTTGGAAGTGTCCG
GGACCTTTCGCCAACATTTCGCTCGGCTCCTGCAACAACACCACTTCTAG
AATATGCTTCTTTTTATTGGGGGGAGCACACAAGAAAGGGGATGACGGAA
AATGTGAAAACGCTTGCACTGAGACTTCTGTATAGATTTGATGAGCATAT
ATCTGCTCAGTTAATGTTATTGCACTATAAACGAGATGTATGCTCGAAGC
CTTATTTTTATGGATGGAAAGGATCTAGAGGATTTACGGGACTCCACGGA
GTAGCATTTCTCGGGATCGTTGGGCTGGTTGCTGCTGTATTAGGGATGAA
GGAATGGGATGTTAATGCAAGCGATAGGACAGGGAGTACGGCCCTCACAT
GGGCAGCGGGGGGGGCATGAGGAAGTTGTAATGGTGCTGTTGGATCGAGA
GGATGTCAATCCTAACCAGGGAGACATGTGCTATGGCCGAACACCACTCT
TGTTGGCGGCTGGGC

Sequences in the Contig:

SY0AAA45YI05FM1