Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA42YG02FM1
Length(NT) : 572
Best Gene Model Blast : Link to GSTUMT00006625001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_01918
Accession: ref|XP_001597722.1| Score: 427 E_value: 1e-40
KEGG Definition: glutathione S-transferase [EC:2.5.1.18]; K00799 glutathione S-transferase
Accession: aor:AO090023000149 Score: 418 E_value: 7e-40
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0867 Score: 252 E_value: 7e-23
PFAM Definition: GST_N, Glutathione S-transferase, N-terminal domain. Function: conjugation of reduced glutathione to a variety of targets. Also included in the alignment, but are not GSTs: * S-crystallins from squid. Similarity to GST previously noted. * Eukaryotic elongation factors 1-gamma. Not known to have GST activity; similarity not previously recognised. * HSP26 family of stress-related proteins. including auxin-regulated proteins in plants and stringent starvation proteins in E. coli. Not known to have GST activity. Similarity not previously recognised. The glutathione molecule binds in a cleft between N and C-terminal domains - the catalytically important residues are proposed to reside in the N-terminal domain..
Pfam Number: pfam02798 Score: 139 E_value: 8e-10
Swissprot: O59827|GST2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004364 = Molecular function: glutathione transferase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>SY0AAA42YG02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCATCGTACTAAAGTTTAATCGACACTCCAAGTCCCCTTCCCAA
TTCCAAACTCCCACAACCCGCACAAAAAATTCACAAAATGTCTCCTCCCA
GCATAACCCTCTACTCCCACAGGGCCGGTCCTAATCCGTGGAAGGTCGAC
ATCGTTCTCCGCCACTTGAACATCCCCTTCGAAACCGTCTTCATAGGGAT
CAACGGCGAGCACAAGCGCCCCCCATACACCAACATCAACCCGAACGGCC
GCGTACCCTCACTCATCGACCACTCCAACAACGACTTCACCATCTGGGAG
TCCGGCGCGATAATGCAGTACATCGTGCAGAAGTACGACAAGGAACACAA
ACTGCTCTTCGATAACTTCGAGGACAACATGCACGTGGAGCAGTGGTTGA
TGTTCCAGATGAGCGGCCAAGGACCGTATTATGGACAGGCAGCCTGGTTC
ACTCGCTATCATCCTGAGAAGGTCCCGAGCGCGATTGACCGCTATGTGAA
GGAGATAAAGAGGGTTCTTGGC

Sequences in the Contig:

SY0AAA42YG02FM1