Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA38YH05FM1
Length(NT) : 253
Best Gene Model Blast : Link to GSTUMT00003504001 E-value : 4e-76
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An16g07795
Accession: ref|XP_001398078.1| Score: 135 E_value: 5e-07
KEGG Definition: hypothetical protein
Accession: ang:An16g07795 Score: 135 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA38YH05FM1
TGTTACAAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAATTC
TGCAATTCACATTACCTATCGCATTTCGCTGCGTTCTTCATCGATGCGAG
AGCCAAGAGCAATGTAGAGCAGACCCCACCCAACTCTCGTAAGCGTCCTC
CAACAAAGACATCACCAGCCGAGGACCGCTATGCCGGAGCTTACGTTACT
GGAAAGTGCTCGACCTGTTCAATCACCTTCGCCACGGCCCAGCAGTTTTA
CAA

Sequences in the Contig:

SY0AAA38YH05FM1