Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA35YM24FM1
Length(NT) : 575
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: heat shock protein sspB-Aspergillus niger emb|CAK40452.1| heat shock protein sspB-Aspergillus niger
Accession: ref|XP_001393974.1| Score: 439 E_value: 5e-42
KEGG Definition: sspB; heat shock protein sspB-Aspergillus niger
Accession: ang:An09g06590 Score: 439 E_value: 3e-42
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0020 Score: 476 E_value: 8e-49
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 596 E_value: 1e-62
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAA35YM24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAACTTTTTTGTACAAAGTT
GTCCCCGACGAAGATGAACAATACATCTGGGAGTCGGCTGCTGGTGGTTC
TTTTACTATCAAATTGGATGAGACCGGAGAAAGAATCAAGCGTGGTACCA
AGATTGTCCTTCATATCAAGGATGGTCTGCAAGAGTATCTCGAGGAGTCT
AAGATTAAGGAGATCGTGAAGAAGCACTCCGAGTTCATTTCATACCCTAT
TTTCCTCCACGTCACCAAAGAGGTTGAGAGAGAAGTTCCTGACGAGGATG
AGGAGGAAGAGAAGACAGAAGAGGGTGATGATAAGAAGCCCAAGATTGAA
GAGGTCGATGAAGAAGAGGAAAAGAAGGAGAAGAAGACCAAGAAGGTGAA
GGAGACCAAGGAAGAGGAAGAGGAGCTGAACAAGACAAAGCCCATCTGGA
CTCGTAACCCCTCCGACATCACTACTGAGGAGTATGCCAGCTTCTACAAG
TCTCTATCCAACGACTGGGAAGATCACCTTGCTGTCAAGCATTTCTCGGT
TGAGGGCCAACTTGAGTTCCGCGCC

Sequences in the Contig:

SY0AAA35YM24FM1