Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA30YA19FM1
Length(NT) : 376
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_07315
Accession: ref|XP_001554178.1| Score: 292 E_value: 3e-25
KEGG Definition: hypothetical protein
Accession: yli:YALI0C07953g Score: 283 E_value: 2e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 409 E_value: 2e-41
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 459 E_value: 4e-47
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAA30YA19FM1
TTGGCTCCAACAGAACAAGATCTTGAAAGTTATCAAGAAAAACATTGTCA
AGAAGTTGGTTGATATTACCAAAGATTTCGAGCTTGAGGAGACTGAAGAT
GAGAAGAAGCAGCGTGAGGAGGAGGAGAAAGCTTTCGAGGGATTGGCTAA
GACTCTCAAGGAGGTTCTCGGTGAGAAGGTCGAGAAGGTCGTCGTTTCCC
ACAAGTTGGTTGATGCTCCCGCTGCTATTCGTACTGGTCAGTTCGGTTGG
TCTGCCAACATGGAGCGTATCATGAAGTCACAAGCTCTGCGTGATACTTC
GATGAGCTCGTATATGGCATCCAAGAAGACCTTTGAAATCTCTCCTAAAT
CACCAATCATCAAGGCCTTGAAGGAG

Sequences in the Contig:

SY0AAA30YA19FM1