Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA2YP16FM1
Length(NT) : 345
Best Gene Model Blast : Link to GSTUMT00010734001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An18g03040
Accession: ref|XP_001398764.1| Score: 286 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ang:An18g03040 Score: 286 E_value: 8e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA2YP16FM1
TTGGGCCTTCTTCTATGCTCGCAAGAAATCAATGAGGAGGGCACCTACTT
GTTATCGTGGCATTTGTATTGTTAAGGTCGGGGATATGTCCTGCGCAAGA
TTGAAGGGTGCTATCACACCGGAGGAGGTTCTTCCGTCAAACCCGGCAAC
CACTGGTTTTCTGGTTGTGGACCCGAAAGAGGGGTTCAATGTTCGTAACT
TTCACATCCAAGTGGGAAAGTTTGCGTGTTTATCTGATATCATCATTTAC
GGAGATAACGATGTCGATCCCGGGGAAATCACCAGGATTGCAAAGCGGGT
CTCTACCGCCCAACTAGAATACAGGGCTCAATACCAAAGGAACTC

Sequences in the Contig:

SY0AAA2YP16FM1