Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA25YE05RM1
Length(NT) : 452
Best Gene Model Blast : Link to GSTUMT00003206001 E-value : 1e-122
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001214749.1| Score: 125 E_value: 8e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG01614.1 Score: 122 E_value: 8e-06
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1977 Score: 118 E_value: 2e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAA25YE05RM1
ATGATAACACGACTTCCCTTCACGAAGAAAACCAAAGTCTATCTGGTGCC
TCTGCAGGGTAGATAACCATCTATATAATACACAATCCCACATCCGCGCA
AAGAATAACAAACAACACCCACCAATAAACGCCAGCTGGAACCAAATCTC
ATGATACAGCCCATAAAGCGGGGGAGAAAGCTAAAAGGCCAATAATGCCA
GAACCCTCTCCCCAATACTAAGTTACTTACAACTAATCATCTCTCCTCTG
CACCCTCTCCTTCTCCCTCTCCACCCACCTTCCAAAATCCTTCCTGAACC
CGCCACCCTTCCCTTTCACTCCCTCTTCAAATGTCACGACCTTCCCAACC
CCGCTCTCGGTCCCAACGCCACCAAGGTCCAGTAACGGGATCATCGAAGG
TCTCCCATGCGCGCACTGAAACGGAAACTTGCACTCCGCTAGTTTGCCAA
TC

Sequences in the Contig:

SY0AAA25YE05RM1