Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA19YK09FM1
Length(NT) : 212
Best Gene Model Blast : Link to GSTUMT00007680001 E-value : 1e-08
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 203 E_value: 1e-17
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 182 E_value: 4e-15

Sequence:
>SY0AAA19YK09FM1
TTGGGCCTGCTATGCCTGCTATGCCTGGCGGTCTGGGAGACATGGGAGGC
GGTGGCATGGGCGGTGGTATGGGAGGTGGTATGGGAGGTGGTATGGGAAG
TGGTATGGGAAGTGGTATGGGAAGTGGTATGGGAGGTGGTATGGGAGGTG
GTATGGGAGGTGGTATGGGAGGTGGTATGGGAAGTGGTATGGGAGGTGGT
ATGGGAGGTGGT

Sequences in the Contig:

SY0AAA19YK09FM1