Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig989
Length(NT) : 885
Best Gene Model Blast : Link to GSTUMT00004847001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig989
GCACTGGGAATAAATCATACCCAGTGACAACCTGTTACACCTACTTCTAA
CCCCTAAAGGAGCCCCCCCAGATCCTTATCTCTAATGGCCACCACTACTA
CAGCTACCTCTCCTCGCCCCGATGAAGAGGAGGACTCGACCCCACTCCTC
GGCCAAGTGACTGGCCGAGATGAGCTCCTCGTCCCGGACCCAAATATCTA
CATAGAAGTCGTCGAAGCGCCCTGGGACTCCATCTCACAGCACACCGCGT
TCACCGCTCGATTAGTCATATCCTTACTCATGAGCAGTCTGCTACTATGG
CATTTCACCGTTGAGACCCTAGCTCAAAGGCTGGGGATATTCCCATTCCA
GGCAATGAACATATCGTGGACTGCTCAGGTGGTGTATATGTGGCTGATGA
CCTACTGGACCTACAAAACCACAACCCCAGCACATCACGCCTCCTGGCCA
TCATTCACCCCTACATCCCCATCGCCTACACCATCATCATTACTAATCCC
AATAACGTTCCAACGCTTCCTCGACATAACCTTCCCATCACCCTACTACA
CATTCAAAACCTGTGCCTTTTACTCCTTCTACACGACCATAACCCTATTC
CCCATATGCGTGACAATACTATATCTTACCACCCTCCTCCCGCACATGCT
CTCCCACCCCGCTCTCCATCTAAGCATCCCAGAACTCCTAATAAGCACCC
TCAACACACCCATAGTCCTAGCGGAGATCCTCCTACTGAACTCCGTGACG
CCGAATACTACGCTGCTGTCTCCGAGGGTGCGGGCGCTGGAGATCACGTT
CTGGGTGGTTGTTTACGTGGATGTTTGGGTTTGGCTGGGGAATGCTGTGG
TTGAAGGGGGGCGCGAGTTGGATTGGAGGTTTCTC

Sequences in the Contig:

SY0AAA39YM23FM1 SY0AAA53YA10FM1 SY0AAB46YE13FM1
SY0AAD32YP21FM1