Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig987
Length(NT) : 810
Best Gene Model Blast : Link to GSTUMT00007680001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 185 E_value: 8e-15
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 162 E_value: 4e-12

Sequence:
>Contig987
TTGGGGGAGGTGGTATGGGAAGTGGTATGGGAGGTGGTATGGGAGGTGGT
ATGGGAGGTGGTATGGGAGGTGGTATGGGAGGTGGTATGGGAGGCGATAT
GGGGGGTGGAATGGGCGGCGGTATGAGCGGTACGGGAGGCATGCCTAATG
GGATGCCAGGAGGCATGCTTGGTGGTATGCCCAATGGCCTCCGCGGCGAC
CACCCCCCACGCGATGCAGACATCCATGACCCCCGAGGCCGCGACTCCCG
CCCAACCTCCCAACAAATGCCCCGCCATGACCCACCCATGGACCCCCACC
GCTCGAACTCCCATCACCGAGGACCCTCCTCCCAGCCCCGCCGCCGCCGC
AATTCCAGCTTCCACAATGAATCCTTCCCCCCTTATCGCGAGTCCCACCA
CCCTCGTCGCGGCCGCGCCGCCACAAACCCAAACCGTGCAACAATGGATT
CTACATACTGGGACTCCGACAAAATGCACCGCACAGACGAATGGGTTGAT
TCAGTCAGCAACAGCAGCGGCGTAGGCTCCACAAGCAGCAGCCAAGACGG
TTATCTAGGCGCCAACGGCGACTACGTCCTCGACACACCACCCCCCGCCC
GCCGCCGCAGCATATCAGTCCACGGCGAGCGCGAGCGTGATCGGGAATAC
CACCACCCGCTCCATCGCGGCCGAAGCTTCAGAGAACCCCATCGACACAG
CACTTACAACACTGGCGCTGGACGCCCGGCGATAGAATACGAATACGCTG
TCGCACCCCGAAATGGTGGTTCTGGGGGAAGGCCAAGGTACAGGACCGCG
TATCACGGTA

Sequences in the Contig:

SY0AAA25YJ02FM1 SY0AAA39YM18FM1 SY0AAB47YF16FM1
SY0AAB49YP03FM1 SY0AAC56YC15FM1