Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig98
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00000577001 E-value : 1e-111
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig98
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTGAAAAAAAAAAATAC
TCACTCAAAAGTTCTTTATAAAATATACCCCCTACCCCACGATTAAGATA
GTTATCATGGACGTTTAGTTCCTCTCCCCGATACAACCTCAAACCTCGTT
TTCCCACGCTTGTACCCCTGTAGAATCCTTCACCACGCCTTCCCCAGAGA
TCTACGGACCTCTGAGCCCTTCGCTTAGCGACATTACCCCACAACAGCCA
GTCACCATTCTTCCCTCGGAACCATTGTGTTTCCCTCCAAACGACCAGCC
ATGGGCCCTCCACAACCCCTCACCAGAGGCTTTCGCCGCAAGTACTAGCC
TCAGACTCGCTTCCACCGCTGCCCCCGACTCCCAGGTCACCAGCCGTTGC
TCATTTCGACAGAACCAGCGCTCACGACAACCAGATCAGTTTCGACGATC
CCGTGCTCTTTCCTCAGCGAGCGCAACCATCCCCGCGTACTCTCCCTAAT
CAGCTGCAACAGTCGCAACAACAATCACGCACTGCTCAACCCCCGCAACC
GCGAAGAGTAAGCGAGATTGTTCACGGTCTCGGATACACTACAACGACGT
CTTCGTTCAACCATCGGCAAGCCTCAACCTCG

Sequences in the Contig:

SY0AAA13YN21FM1 SY0AAB25YG04FM1 SY0AAB32YC18FM1