Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig935
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 6e-93
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61634.1| Score: 676 E_value: 2e-69
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 676 E_value: 1e-69
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 590 E_value: 6e-62
PFAM Definition: HATPase_c, Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. This family represents the structurally related ATPase domains of histidine kinase, DNA gyrase B and HSP90..
Pfam Number: pfam02518 Score: 127 E_value: 3e-08
Swissprot: O43109|HSP90_PODAN

Sequence:
>Contig935
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGAAACACTCTCGACTTTTCTCAGAGCCCAATCAATTTCTCCT
GCATCTCCTCATTCACCTCTCTATTTCCCTGCACCTTTAGAGATTCATAG
ACCCGAGAAGATAGCAAACAACCATTGCCATGGCTGAAACCTTCGAATTC
CAAGCTGAGATCTCTCAGTTGCTCTCCCTCATCATTAATACTGTATACTC
GAATAAGGAGATTTTCCTTCGAGAATTGATCTCCAATGCCTCAGACGCTT
TGGACAAGATTCGCTACATTTCTCTTTCCGACGCTAGCGTCTTGGAAGAG
GAGAAGGATCTGAAAATTCACATTATCCCTAACAAGGAGGCCAAGACTCT
TTCAATTTTTGATACTGGTATCGGCTTTACTAAATCTGATTTGGTAAACA
ATCTTGGTACCATTGCCCGATCTGGTACAAAGCAGTTCATGGAGGCCCTG
TCCGCAGGTGCTGATATCTCGATGATTGGTCAATTTGGTGTTGGTTTCTA
CTCGGCATATCTTGTTGCCGATAAGGTTGAGGTTGTTACCAAGTCGAACG
AAGATGAACAATACATCTGGGAGTCGGCTGCTGGTGGTTCTTTTACTATC
AAATTGGAT

Sequences in the Contig:

SY0AAA38YG20FM1 SY0AAB59YB13FM1