Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7625
Length(NT) : 1473
Best Gene Model Blast : Link to GSTUMT00008558001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An07g08830
Accession: ref|XP_001391957.1| Score: 668 E_value: 7e-68
KEGG Definition: hypothetical protein
Accession: ang:An07g08830 Score: 668 E_value: 3e-68
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0251 Score: 405 E_value: 5e-40
PFAM Definition: ANTH, ANTH domain. AP180 is an endocytotic accessory proteins that has been implicated in the formation of clathrin-coated pits. The domain is involved in phosphatidylinositol 4,5-bisphosphate binding and is a universal adaptor for nucleation of clathrin coats..
Pfam Number: pfam07651 Score: 327 E_value: 5e-31
Swissprot: O60167|YHC3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig7625
TTGGCTTATGGAGATGTGAGGACGGACTACGTTCGCAGTGGTGAGGGAAG
ACTTAGGAAGTTGAGCATTGAGAAGGGGCTTTTGAGAGAGGTCGAGTGTG
TCCAGACCCAAATCAGGGCACTATTGAAGTGTACGTTCCTCGATGATGAT
GTCGATAACGAAATTTCTCTTCTGGCCTTCCGATTGTTGGTTATGGACCT
TTTAGTTCTGTTCCATGTCGTGAATGAAGGTGTCATCAATGTTCTTGAAC
ACTATTTCGAGATGTCACGTTACGACGCCGAAAGAGCCTTAGAGATCTAC
AAGACGTTCACCAAGCAAACGGCTGACGTCGTCGAATATCTGCAGCAAGC
CCGGGGAGTAGAAACGGCGACCCGCCTTCAGATCCCCAACTTGAAGCACG
CACCAACCAGTCTCACATCTTCATTGGAAGAATATCTTCATGATCCAGAT
TTTGATGTCAATAGGCGACAGTATCTCGCTCAGCAAGAAGCGAAGAAGAG
TGGGAAGCCTGTTCCCGCTGCAAAGCCAAAATCGCCACCACCAGGGCAAC
AACCCAAAACCTCAGCAGCGCAACGCTTCCCGAGTCCCACTCCTGCCAAC
CCAGTGCCCGAGCAAGCCCAGCCGAAGCCTGTCGCCCCAGATCTCATCGA
TTTCTTTGAGTCAATTGAGTCGGAGCAGACTCACATGTTTAGCAATCAAC
CCACTAATGGGCAACAAATACAGATGCCTCAACCTCAGAATCAATTTGCT
CAACAAGCCCAGGTAGACTCTGCGTTTGGTGCTCAAATGCAGCAGCAGTC
TGCGCCCCAACAACCTTTTGTGGCACCTCCGCAACAGTTCCCTACACAAA
CAGGGCCCACGTTTGCAACTGGTTACCAAGCGCAGAACCCCTACAACCAA
GTTGCCCAGCAACAACCCCTCCCCCCAATTATTCAAACGAACAACCTGCC
GGCCATACAACAAACACCTCAACAGATACAGACAAGCTTTACCGGAGCAG
GGTTTGGAGGCTATACTCCATCAGATCAAAATTCTGTAACTGCCCCCTTA
ATGTCTACGGTCCCGCAACGATTCAACCAACCCATCCAACAACCTAACTA
TCAGCAGCCCCAGCATCAACCCCAGCAGCAGCAGCAGTCTCTTTCTCCTG
CCGTTAGTTTGTCCACTGGTGCGACAGATACCAATCCATTTCGGCAATCA
ATGATGATGACCGGGTCTGTCTCAACAGCTCCATCTCTCTACGCAACATC
ACCACCCGTGTCCGCACAGCCTAAATCTACAAATCCGTTTGCGAGACAAG
CATCACCCACTAATTTGTCTCCGACATCTCCTCCCTCCGCATATCCTATT
TCAACGCAATCTACATCTGCATACCCTCAGGCAATGCCAATATCGGCGCA
ACCCACAGTGCGCTCAATGCCCACAGGGACTAATCCCTTTGCAAGGAGTG
TGTCGAGTGCTGGAACTGGATTG

Sequences in the Contig:

SY0AAA61YO17FM1 SY0AAC60YC06FM1 SY0AAC6YI03FM1
SY0AAD8YJ14FM1