Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7549
Length(NT) : 638
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 3e-54
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 195 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 195 E_value: 6e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig7549
TTGGTCGTCAACAACCACACAAGTTACGAACCACAAACGCAAAAACGAAA
GCACTGCGAAAACATCTCCCAAAGAAAATCCTCAAAATGCCTTCCTATAT
CATAACCGTGAAGCCAGAGACCTCCGACTCGGAACTGCTAAAGATCAAGG
ACGACATCGTCGCCCAAGGTGGGAAAATCACTCACGAGTATTCGCTAATC
AGGGGGTTCTCGTGCGAACTCCCTGTTAACCAGGTTTCCACCTTGGAGAC
TCATAGACATGTGCAGAGCCTGGAGGTTGATGGCACGGTTACTACTCAGT
AGTGGTAAGTTGTAAGCAGTGTTATATATTCTAGCTGAGGCGATTGGCAT
CCATACGGGTTCTCCCGTCTGGCTCCGCGAATGCATCGATCTGTTGGACT
GATGTGGTCTCCGCCAACGGTAGGTGCGCTTTTCGGTCCAGACAATGAAT
AAAGGACACACACATTTCCTACTCCAGATGGATAGTCGTCCGCTGTGCAT
AATAATGTCGTGGGTGATACCGGTATGGGGTGGTTTTGCCACTCGGTAGG
GGTTGATTGTTTCACGTCTATTCTGTGTTCTATTCTATTTGATTTTTCTC
TCCTGTCTCTTGCTCTGCGTTGCCCGTAGTGGGCAGGG

Sequences in the Contig:

SY0AAD18YK20FM1 SY0AAD61YK08FM1 SY0AAD63YL13FM1