Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7408
Length(NT) : 1841
Best Gene Model Blast : Link to GSTUMT00001007001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_11864
Accession: ref|XP_001802101.1| Score: 217 E_value: 2e-15
KEGG Definition: dual specificity phosphatase
Accession: aor:AO090026000622 Score: 206 E_value: 2e-14
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 187 E_value: 1e-14
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 188 E_value: 9e-15
Swissprot: O13453|PMP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0017017 = Molecular function: MAP kinase tyrosine/serine/threonine phosphatase activity
GO:0005515 = Molecular function: protein binding
GO:0006470 = Biological process: protein amino acid dephosphorylation
GO:0000749 = Biological process: response to pheromone during conjugation with cellular fusion
GO:0032005 = Biological process: signal transduction during conjugation with cellular fusion

Sequence:
>Contig7408
TTGGAGAAAGTGCTTGTTCATTGTCAATGTGGCGTTAGCCGTTCAGCAAC
ATTACTGATCGCCTATGCTATGTTTAAATCTCCCGAAAAGACAATGCAGG
ATGCCTATAACGCGGTTAAAGGGCGAAGCAAGTGGATTGGGCCGAACATG
AGTTTGATTTACCAGTTGACAGATTGGAAGAAGAAGATCGCATCCGATAA
CTCACAGCCGGTGATGGCGGGGTGGAGAGGGGGAGGTGCAGGAAGCGCTG
GAGGCCGAGGGCATACAAAAGTAGACACTAGGGGTGGTTTTGGAAGAGCT
GGTCCCTCAGATGGGCCTGGGATGTCAGAATCGATCCCGGAGCCTCAAAC
AGCACCATTGCCTGTCTGCCGGAATTCACCATCCTCATTACCTTTGGATA
CGTGCATGGGTCAATCTGGAGATCATCCAATCCCGCAAATGGTGAGGACG
AGATCCGAGAATGGTGGATTTATATCTGGTGTTTCTCCAGGGCCTTCTTC
GGCTCCACCGGGCATGATAACGATTCCTGGTGCCTCAGATATTTCTTTCA
AAAGACAATCATGGCCAGAGAAGATCTCAACGCCACTTTCTGAGCGAGCT
GATTCTCCACTCGCATTGTGGGGGATGGGGGCTTCGGAGAAGTCGCGTGT
AGGCTCTGTCCCTCCGTTGCTGCAATCGTCTGCATATCTTGTTCAGTGCG
AGGAAATATATGGTCGAGATGCCGGAAGCGGGGATGACGATCTTCCCCCG
CCCCCACCGAACTTTACCAGCCCTCGGAGCAGCACCTATTTTCCTGTCCC
GATGAGGCGTTCTGGAAACTTCTCCATTTTCACAGATCCCAGGAGTCCAA
CACAGCGCGGCGAGACGCCGATCGTTAGGAGCATCTTTGACGTCCTGTAG
CAACTACTGTGGGGCCGGTGGAGCGACTCGGCCGGCTGAATCAGGGGGCT
CGGATGGGTTCTAGGCAGTCGGGGGTTAGCTTTAGGTTCCTTTGTAAGGG
CTTATTTGTTACTAATCGAACAAAGGGAGTGGGGGTGTAGATCGTCGCGG
AAGCAGCGATGGAGCATTCATCGCCGGCTGGAATTTGGCCGTGGGGGGTC
TAAAAAACAATTTCTTTTTATCTTTCCTATATTCAGTAGGCTTTACTCGG
GGGAAACCGGAGCATGAATGATACCCTTCTTTACTTTTTCTTCCCGCTTC
GTTCCTTTTTCTTGTGGGGGTTGATAGAAATGGAGGAGTGATAGGATGTG
ATGGGTTTCGAGCACAAGGGGAATGGGCGCGCAGTGTCGGTCGTTTGGAT
CATGATTTCCCTTTTTCTTTTTCCCTTGCTAAGCCAGTTTATGGTTGGGA
TCTCGAATTTCCTTCATATTCCCGATTTTTTCCATCTTCTACGATCGCTT
GATAAAGGTATTACGCCTAATTTTTATTTTCGCTTCCTATCCCATCTGCC
GTCTCCTGTACTGTACATTTTTATGAGATGACTGGGAAGGAGAGCTCCTG
GGGAGACTATCCTTTTTACTTTCATTTTTTCCCCACTTGGTTTTTATTTG
TTTCAACCTTTTTTTACCGCCCTTAGCCGAGAGATCAAAAAAACACTTTG
GGTATGATACCTCATTTTCATTCGTTGTAAAGCCCCCCCTTTTTTTCGGG
TTTCCCTTTTACAACTCGATACCCCCCACCTCCCCTTGTGTGCTCGCTGT
TTTACTCTACTTTCAGGAGTTCGAGTCTTCGCTCCAAATCACTGATTATA
TTTATTTCCTTATATTCTGGTGTTCATTTTTCTCTTTTTCTGCCATCTGT
TACTATCGGACTTTTTTATTTAGTTTGCTTGCTTGTGTTTT

Sequences in the Contig:

SY0AAA15YP08FM1 SY0AAB32YG09FM1 SY0AAC39YH10FM1
SY0AAC55YB24FM2 SY0AAD36YH05FM1 SY0AAD39YI13FM1
SY0AAD5YP24FM1