Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7291
Length(NT) : 970
Best Gene Model Blast : Link to GSTUMT00001773001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN6228.2
Accession: ref|XP_663832.1| Score: 172 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: ani:AN6228.2 Score: 172 E_value: 6e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig7291
TTGGGCGGCGCTGAGGTTTGTTGGGATAAGGAGGCAGGATCGAAGCCTGT
TAGCCTGGAGGATATGAGTGAGGAAGAGAAAGAGTTGTTTGCCTCCAATG
TGAACTCTCCTCATAAGGCGCCCCCAAATCAAAATAATCAAGGAGCAACG
AATCATCACAACACCAATCATACCCCACCACAGAACCGAAATAAAATTAC
CGCCCCTCCTGGTGCAGGCGCTACCGGTGTCAATCGCCCGACAAACCGAC
GCCGTGAAACCTCTGATGCCGCCCTTACCAATTCTCCTTTCAGCTCTGCC
CCCCCTCAATTGCCGAGACGCAGGACTGAGTTGAGAGACGAAGACCAAAC
TCGGGAGGGTGGCGGCCGGGATAGGACTTTATTTGGACGCTGGGGTAGTA
CTTCTGGTACATCTGGTCAGGCTGGGGATGATGATCATGGCAAGGAGAGA
GTTGAAGACGGTTCGGGAAGCGGCGGTAGAAGTTCTGGGTTGTTTAGGAG
GGGCAGTACAGCTTGGGGACCTAGTGGGAGTACTGGCGGAGGTGGATTCG
CGAGTAGCGCGTTAAATAGCCCGATGGGCACGTTTGGAAATGGTGTGTTT
GGTGGTGCAATGGGCGGGTTTTCCCTACAGAGCGCCTCTTCGGAGAAGCT
GAAAACAAGCAGTAATGCCGGTAACACAGGGCAGAAAGGTTCAACGGCGC
AACCTAAAGTTGAAGAAGAGGACGAACAAGCTGAAGATACCCAGAGACCC
CGCTCCCCCAACCCAGATGGATTGCGTGAAGAGCACGAACGCGAGCGACC
TATGAGCTCGGACACTGATCCGTTTGGTCTTGGTGGGGATGGGGATGACC
GTGAGCATGACCATGACCAACGGCAAGAGCAGCAGCAGCCACAACATTCC
CCGCTTCCTACTCCCAGTCTCGAGCAGCGTATGAAAGATAATTCTTTCAA
CACGACGAGTAATACTCAAA

Sequences in the Contig:

SY0AAC10YE13FM1 SY0AAD57YG09FM1