Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7175
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00008471001 E-value : 1e-16
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig7175
TTGGCGGGGCGTATATATGTGGGAGGGAGTATAATATCTTGCATACGAAG
CGGAGTGAGCTGGAAAAGCTGCGAAGTGTAAGCGAACAGGAACAACCACG
GCTCGGCGGCGAGGCAATTGCTGACACGTGACTCGTTGAATGTTGTAGAT
TTTGGATGAAAGAGATCGAGGAATAAGTCGAGATCGAATGTTGTCGCGTT
CGGATTCGGATAATATTCGGTTGTTTACGAATGAACGTAAAGCGATTTAA
AGATTTTGCTCCCCTTTCCCCCGTCTCCTACTAACCCGCAGCCAACCTCA
CAACCATTTGGGCAACACAGAAGCGTTTTTGTATCCAGGACACGCCGGAT
CTGCACGCCTTGCCCACCTAGGGCACCGCCTTGCCCCGAATTGCCGTTCT
GACGCCTGGTTATTGGTTGGAGGCCCCCCGTTCATTCAATACGTTTACTG
GCTCGAAGCCATGCTGGTTCTTTCGTACCTTTTGTTGCCCTCTATCCTCG
GAGTCTGCTTTGGAGTGGCGTATGGTATTTATATGAGGATGCAGGACTTT
GTGTGGGTCAGCTGTCGACGGCTTGTGGTGTTTCTGTTCCTCCTGTACTG
GAAAATTCAGAACTTTATCGCTTCGC

Sequences in the Contig:

SY0AAA7YL24FM1 SY0AAC17YP17RM1 SY0AAD53YG23FM1