Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig7139
Length(NT) : 820
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212609.1| Score: 641 E_value: 7e-69
KEGG Definition: hypothetical protein
Accession: fgr:FG03163.1 Score: 625 E_value: 6e-68
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 173 E_value: 2e-13
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 170 E_value: 4e-13
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig7139
TTGGTATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTTACGTACAAG
ATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCACATTATCTATGA
GAAAAACATACCCAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACC
TTCTCATGGGAGCCAAATCCGGACTGGAGCGAGTTTTACGTTGGCGGAGA
AGAAATTTTCCAATACATGAAGCGTACAACGGCGAAATACGACCTTGCAA
GAGATGTTGTTTTCAATTCCAAGGTTGTGGAAGCCATCTGGGACCAGGGG
CGAGGTAAATGGGAGCTCAAGATTGAGCAAGAGGGACGATTTATCTGGGA
CGAATGCGATATCTTTATAAACGCCTCAGGGATCCTGAATAAATGGAAGT
TACCATCCATTGAAGGAATAAACGCTTTCAAGGGACACTTGGTGCATAGT
GCGAAATGGGAGGATACTTACGACTTTGCTGGAAAGAGAGTTGGAATTAT
TGGAAACGGATCTTCCGCACTTCAGATCGTCCCCAAGCTACAGGAAGTCG
CTGGACACCTAGTAAACTTCATGCGTACCCCAACCTGGATTAGTGCGACA
TACTCTTCTGAGCTTCTTCCTGATGGAAAGAACTTCTACTAAGAGCAGAA
GTCTGAATTCCGGAACAATCCTAAGTTGTTAAACGAGTATCGCAAAAAAA
TTGAGAGCGGCTTCAACAAATTCTTCTATGCCCTTCTCAACGACTCCCCT
GCCCAAGCTGCTATAACGGAGCAGTACACACAAATTATGTCCGAGCGCCT
CGGTAACGACCCAGAGCTTA

Sequences in the Contig:

SY0AAC20YC24FM1 SY0AAD11YI24FM1 SY0AAD40YE23FM1
SY0AAD51YN05FM1 SY0AAD55YF06FM1