Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6705
Length(NT) : 2253
Best Gene Model Blast : Link to GSTUMT00000577001 E-value : 0.0
Numbers of ESTs : 179

Blast Results:

Nr Definition: hypothetical protein SNOG_01521
Accession: ref|XP_001792159.1| Score: 339 E_value: 2e-29
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00602 Score: 312 E_value: 1e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2244 Score: 272 E_value: 2e-24
PFAM Definition: DUF255, Protein of unknown function, DUF255..
Pfam Number: pfam03190 Score: 271 E_value: 2e-24
Swissprot: P37512|YYAL_BACSU

Sequence:
>Contig6705
CGATCTTTATGGGGATAAAGTTCTCGTTCAAAATCCTAGCGATCTCTTCG
TTTTCAAAGCTCTCACGTTCCATAACATGACACCAATGACAAGCCGCATA
CCCAATACTAACAAACACAATCCTGTTATTCTTCTTCGCAAGCTCCAGCG
TCTCCTCATTCCACAGCTGCCACCGAACTGGATTATACGCATGTCCACGA
ACATAAGGACTCTGACTCTTCAATAGCTGATTAGGTTTCAATTCCAACTT
ATCCTTAGCTCCAGAAGCTTCTTCCGAAGCCTCACTCTCCGCACTCCCAC
CCCCGGCCCCACCACCCTTACCAACAACAGAAGAGGTAGCTTTACCCCCC
GACGAGGCAGATATCGGGGTTGGTAAAGCCACCGGCTTCACGACGCCCTT
GGAAGCCATGATTTATTTTATTCCCCAGGAAAAAAGGTTCAAATAAAAGG
CGTACGATCAGGCGACAAACGTTGGCCAACTTTTTTGTACAAAGTTGTCC
CCCCAACTTTTTTGTACAAAGTTCTCCTCGCTGAAAAAAAAAAATACTCA
CTCAAAAGTTCTTTATAAAATATACCCCCTACCCCACGATTAAGATAGTT
ATCATGGACGTTTAGTTCCTCTCCCCGATACAACCTCAAACCTCGTTTTC
CCACGCTTGTACCCCTGTAGAATCCTTCACCACGCCTTCCCCAGAGATCT
ACGGACCTCTGAGCCCTTCGCTTAGCGACATTACCCCACAACAGCCAGTC
ACCATTCTTCCCTCGGAACCATTGTGTTTCCCTCCAAACGACCAGCCATG
GGCCCTCCACAACCCCTCACCAGAGGCTTTCGCCGCAAGTACTAGCCTCA
GACTCGCTTCCACCGCTGCCCCCGACTCCCAGGTCACCAGCCGTTGCTCA
TTTCGACAGAACCAGCGCTCACGACAACCAGATCAGTTTCGACGATCCCG
TGCTCTTTCCTCAGCGAGCGCAACCATCCCCGCGTACTCTCCCTAATCAG
CTGCAACAGTCGCAACAACAATCACGCACTGCTCAACCCCCGCAACCGCG
AAGAGTAAGCGAGATTGTTCACGGTCTCGGATACACTACAACGACGTCTT
CGTTCAACCATCGGCAAGCCTCAACCTCGTATCAGTTCACTCCAACTCAG
CCCCAGGATAATTCTATTCGTACGCCCGAATCAAGACAGATTTCTCAGCA
GCAGCAACAACAGCCTATTCTTGACCCCACCACCGCTGCTCATTACTTCC
AGACTCTGCGCCAATCAGCACGGGCATACAAAATGCAGCAGGAGCAAAAT
ATGAAAAAGATTGATCCTGAGGCCGCCTTTGAGGAGTGGTTCTCGACCGA
TTATCAAGGACTCCCATCCGACTTCTCCCCGCTTACTGGAGTCCACGATA
CCTCTTCGCCATCCATCGGTCCAACCGTTTCTCCTCAAGAGCTTCTCATG
AATCCTCCTACTTCTACTGCTACAACGAATCTCGCGTCCCCTCTGTCTCT
CTTTGATTCCCCTTCTGAGAGCTACGATACATCCCCACTCTTTAATGGTG
ACGATGTTTCGTCGGACGGTCAATGGTTCTCGTTGTTTCCTGAGACGAAT
CCTGATCCTGAGGACTCTGTTGTTTCCCCCACTATGCCCAATATGCCCCA
ACCGGACTGCTCTGGGGATCTTCCTGGACGTTTAGATGAAGAGGGTCCTG
ATTCCCCTAGCACCTCCCCCCGCTATCGCAGCCAAAGCGTATCTACACAG
CGACGTTCGGCAACTTCTGGCGTTCGAAAGAGGGCGCCTTTGCCGCCCAT
TGTCGTTGAAGATCCGTCTGATACTGTCGCCATGAAGCGTGCGCGAAACA
CCCTCGCTGCCCGAAAGTCGCGAGCTAAGAAATTGGAGCGAATGGAGGAG
ATGGAGGCCCAGATTGAGGAACTTAAGGCTGAGGTTGAGCTATGGAAAGA
TCGAGCCCTCGGCCATCCTCGCAGGGTTTGATTTGGCTTTTCTCGGAGGA
AGTGTTTTTTCTTATCTTAATTCCTTTTAACTTGTATTTTTGATGCTGGT
TTGTCTCTTGTGAAGGCGGATGTAATTGGAGGAAAGTGCACATTTTCATT
CTTTTTCTATTTCCGTATCTTGAAGCTTCCCGCGACCATTTGCGCTTTTA
ACGACACGTTACGACTTTGTTTCTTTCTCCACATTTTATGGGTTATACAT
TCTCTAGCCCTAATTTATCCTTCAATTTTATCTTCACCATCAGTCGCCTA
TTG

Sequences in the Contig:

SY0AAA10YG10FM1 SY0AAA13YD04FM1 SY0AAA14YF02FM1
SY0AAA15YO07FM1 SY0AAA15YO15FM1 SY0AAA16YD05FM1
SY0AAA16YO22FM1 SY0AAA17YF03FM1 SY0AAA19YC24FM1
SY0AAA19YD24FM1 SY0AAA1YB21FM1 SY0AAA1YO16FM1
SY0AAA1YP01FM1 SY0AAA21YE10FM1 SY0AAA21YI11FM1
SY0AAA21YI17FM1 SY0AAA21YJ05FM1 SY0AAA25YM18FM1
SY0AAA25YN05FM1 SY0AAA25YN05RM1 SY0AAA26YA20FM1
SY0AAA27YD04FM1 SY0AAA28YO04FM1 SY0AAA29YD09FM1
SY0AAA29YP14FM1 SY0AAA2YB17FM1 SY0AAA2YM12FM1
SY0AAA2YP22FM1 SY0AAA30YM23FM1 SY0AAA31YF09FM1
SY0AAA32YL14FM1 SY0AAA32YO08FM1 SY0AAA34YG15FM1
SY0AAA34YK23FM1 SY0AAA34YP19FM1 SY0AAA36YD12FM1
SY0AAA37YC21FM1 SY0AAA37YO04FM1 SY0AAA37YO11FM1
SY0AAA37YP14FM1 SY0AAA38YF19FM1 SY0AAA38YH13FM1
SY0AAA38YH17FM1 SY0AAA38YI01FM1 SY0AAA39YA05FM1
SY0AAA39YG17FM1 SY0AAA3YA20FM1 SY0AAA3YK22FM1
SY0AAA40YA03FM1 SY0AAA41YE12FM1 SY0AAA41YI05FM1
SY0AAA41YN03FM1 SY0AAA42YB03FM1 SY0AAA42YC22FM1
SY0AAA42YI06FM1 SY0AAA43YN13FM1 SY0AAA44YO12FM1
SY0AAA44YP04FM1 SY0AAA45YJ20FM1 SY0AAA46YL05FM1
SY0AAA47YD20FM1 SY0AAA47YF02FM1 SY0AAA47YK15FM1
SY0AAA48YI21FM1 SY0AAA48YM14FM1 SY0AAA49YI15FM1
SY0AAA4YI01FM1 SY0AAA50YO14FM1 SY0AAA52YA01FM1
SY0AAA52YB18FM1 SY0AAA53YH11FM1 SY0AAA53YK13FM1
SY0AAA54YB08FM1 SY0AAA55YN18FM1 SY0AAA56YC23FM1
SY0AAA58YA09FM1 SY0AAA58YF01FM1 SY0AAA58YJ18FM1
SY0AAA60YA02FM1 SY0AAA62YI17FM1 SY0AAA62YL14FM1
SY0AAA63YN07FM1 SY0AAA7YK14FM1 SY0AAA9YH10FM1
SY0AAA9YN05FM1 SY0AAB12YM24FM1 SY0AAB13YD14FM1
SY0AAB13YL19FM1 SY0AAB13YN19FM1 SY0AAB14YA21FM1
SY0AAB14YH11FM1 SY0AAB15YM19FM1 SY0AAB15YN20FM1
SY0AAB16YE12FM1 SY0AAB16YH13FM1 SY0AAB16YO12FM1
SY0AAB17YE05FM1 SY0AAB17YE07FM1 SY0AAB18YB08FM1
SY0AAB18YG18FM1 SY0AAB19YC07FM1 SY0AAB19YN01FM1
SY0AAB1YG13FM1 SY0AAB22YF23FM1 SY0AAB24YI22FM1
SY0AAB25YA04FM1 SY0AAB25YD14FM1 SY0AAB25YM06FM1
SY0AAB25YO04FM1 SY0AAB27YG19FM1 SY0AAB27YH18FM1
SY0AAB27YL18FM1 SY0AAB28YG20FM1 SY0AAB28YP10FM1
SY0AAB29YC19FM1 SY0AAB2YM09FM1 SY0AAB2YN12FM1
SY0AAB30YB12FM1 SY0AAB30YG07FM1 SY0AAB30YJ16FM1
SY0AAB34YC06FM1 SY0AAB34YK12FM1 SY0AAB35YC12FM1
SY0AAB35YP15FM1 SY0AAB36YA07FM1 SY0AAB38YB23FM1
SY0AAB38YH15FM1 SY0AAB39YC05FM1 SY0AAB39YG07FM1
SY0AAB39YI03FM1 SY0AAB3YB24FM1 SY0AAB3YK03FM1
SY0AAB41YF24FM1 SY0AAB41YI04FM1 SY0AAB41YK03FM1
SY0AAB42YC24FM1 SY0AAB42YF23FM1 SY0AAB42YI23FM1
SY0AAB42YJ14FM1 SY0AAB44YA21FM1 SY0AAB44YN07FM1
SY0AAB45YN20FM1 SY0AAB47YP07FM1 SY0AAB49YE19FM1
SY0AAB4YN03FM1 SY0AAB52YC08FM1 SY0AAB52YK01FM1
SY0AAB53YJ22FM1 SY0AAB53YL13FM1 SY0AAB54YC11FM1
SY0AAB55YD14FM1 SY0AAB55YE15FM1 SY0AAB55YK19FM1
SY0AAB55YP11FM1 SY0AAB55YP24FM1 SY0AAB56YC10FM1
SY0AAB56YI02FM1 SY0AAB56YM20FM1 SY0AAB58YK08FM1
SY0AAB59YD22FM1 SY0AAB5YL08FM1 SY0AAB5YN22FM1
SY0AAB60YC04FM1 SY0AAB61YK05FM1 SY0AAB6YG07FM1
SY0AAB6YJ05FM1 SY0AAB6YK08FM1 SY0AAB7YP12FM1
SY0AAB8YH23FM1 SY0AAC17YM18FM1 SY0AAC29YK07FM1
SY0AAC8YO19FM1 SY0AAD11YJ17FM1 SY0AAD14YP09FM1
SY0AAD29YE18FM1 SY0AAD30YD18FM1 SY0AAD34YN08FM1
SY0AAD35YE13FM1 SY0AAD3YN14FM1