Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6607
Length(NT) : 1984
Best Gene Model Blast : Link to GSTUMT00008492001 E-value : 0.0
Numbers of ESTs : 43

Blast Results:

Nr Definition: cytochrome c heme lyase
Accession: ref|XP_001211930.1| Score: 745 E_value: 1e-76
KEGG Definition: cytochrome c heme lyase, putative
Accession: afm:AFUA_4G04600 Score: 735 E_value: 9e-76
KOG Definition:
Classification: [Energy production and conversion, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3996 Score: 537 E_value: 4e-55
PFAM Definition: Cyto_heme_lyase, Cytochrome c/c1 heme lyase..
Pfam Number: pfam01265 Score: 590 E_value: 2e-61
Swissprot: P14187|CCHL_NEUCR
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig6607
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCTTTCAAGCCTGTGGC
GAACAACACTATCATCGGACATTGGGGGCTTCTGTTCGGGGGGTATTACG
GGATGCTGTTTTCATGTGGTATCTCAACCTCAAATCTAAAATTTTTCTCG
AATGACAGTTACCGTACTCGAAGCCTATTTCGTCTTTGTAACTTGTATTT
TGACTACGGAAATTGGTCGTAGAGGGGGGCACGGGACGGAAATATATGGG
TTCGAATACTGGGTGAGATAGAATCCACGGCATTCCACCAGCGTATACTG
TAGCCAGGGCCTTTAACTTGTCCGTATCGATACCAATGTTGAAAATAATG
GGGAATATTATGAAAGAGACATGGTCGATTACAAATAATTCTTGGCCAAT
CTCGGACTTCAAGGCAAAGCCCAGCTCACAATATAGAAAACCACATCCAA
GGATCCCGATCACAAAGTCCTCTTCCATAGTTCATCCCTCTCCGCAGTTT
GGGTAGATGACTAATCACACCTATCCTACTAATTTTGCCCTCCCCTATCC
AGCACCAGCCAGTGGGGCCACCAACTGCTGCCTGAAAAATCAGCCTCCAC
TGACCTCTTATCTTCAAAAACTCCCCCTCCGCTCCATCAACCCCGCCACA
CCAAAATTCACGAAACAAAACAAAACAAAAAAAAAAAACCTCAAGTACCT
ATCGCATAGGAACACAAACGAAACGAAATGGGCTGGTTTTGGGCAGAGCA
AGAAGAGAAACCCACTCCGAGGGTCAGGCCCGGGCCTCCCCCGAATCATC
CTACGTCTAGATCTCCTCCGCCCTCATGCCCGATGCACAAATCCACACCA
TCAGACTTCTCCGGGGGTTCCAGCAGTGGCAGCGACGTCACCTCCAACAA
TGACATCAACCACCTAAACCTAATGTTCAGCAGCCTCCCGCAATCCCGCA
CCCCGGGGCAAAGGACCAATCTACCAACGGAGCGTGAGACCTCCAGCATC
CCGCGTGGCGACTCCGGGCTATGGGAGTACCCATCCCCACAGCAGATGTA
CAATGCCATGCGCCGGAAGGGTTACGACGACACGCCCGAGGACGCGGTGG
AGAGCATGGTCGCCGTACACAACTTCCTAAATGAGGGCGCTTGGGGCGAG
ATCGTGGTGTGGGAGAGGCGCTTTGGCGGTGGGGTGCTGAACGCCCTGTT
GGATGCGCGCGAGGCGGATGAGGCCGCCGAGAGGGCGGGGGAGAGGGAGC
GAGAGGGATTCCCGAGGTTGGTCAGGTTTCAGGGGAAGAGTCGGGAGATG
ACGCCTAAGGCCAGGATGTTCCAGGTGCTTGGGAGGGTTTACCCGGAAAA
GTTTGGGGGACCTCCGCCGTTCGATAGGCATGATTGGTACGTACTTCGAC
AGGGCGGGAGAGAAGTTCGCTACGTTATCGATTATTACTCTGCGCCACCG
GAGCCTACAGGTGAGCCGGTTTTCTACCTGGATGTTAGACCCGCCATTGA
TAGGCCGAGTGCTATCCTCGAGAGAGCTATGGTGTGGGGAGGAGATCTGT
GGGAACGAGCTAGCGGAGCTGATGTCAGAAGGGCTGCGGCGGAGAAAGCT
AAAAGGGACTCTTCCTGACGGGCTCGTTCATTCCTCAATTAATTAATTGA
CTTTGGGAGTTTTATTTTTGTTCTTTTTTGTGCTTCTCTCTTTCTTTCTT
TTACTTATTTTGATATTTCTTCTGTCAATGGGTCTTTTATGCTTGACGAA
ACCCCTCCCCACTCCATTGAGTCTCACCTTTTCTCCATTCTTCCTGGGTT
GTCCTTGCATCATTCACAAGTTCCTATTCCGAATACTTTTGGCCATCGCG
TATCGGTGGGAATTACAGCTTTTTTAAGGCTCAATCACGGGATTTTTTTA
TTTTTTTTCGCGCAGAGGAAAAAATAACATATCAACTCTCCATTCAATCA
ATACTGTTGGTGCTGGGTGCACTCAACAATTTAC

Sequences in the Contig:

SY0AAA22YF21FM1 SY0AAA22YF21RM1 SY0AAA25YK02FM1
SY0AAA41YH09FM1 SY0AAA41YO18FM1 SY0AAA9YG21FM1
SY0AAB44YC15FM1 SY0AAC10YN18FM1 SY0AAC22YE08FM1
SY0AAC2YA09FM1 SY0AAC31YH06FM1 SY0AAC34YG14FM1
SY0AAC40YC22FM1 SY0AAC49YG06FM1 SY0AAC55YD02FM2
SY0AAC56YG09FM1 SY0AAC60YC11FM1 SY0AAC6YD07FM1
SY0AAC6YO15FM1 SY0AAD10YK18FM1 SY0AAD15YN24FM1
SY0AAD19YE23FM1 SY0AAD20YP15FM1 SY0AAD27YK23FM1
SY0AAD31YD09FM1 SY0AAD36YB21FM1 SY0AAD36YL06FM1
SY0AAD38YA19FM1 SY0AAD38YB18FM1 SY0AAD39YB05FM1
SY0AAD3YJ10FM1 SY0AAD40YO02FM1 SY0AAD43YC09FM1
SY0AAD44YN20FM1 SY0AAD49YC18FM1 SY0AAD52YE04FM1
SY0AAD55YG06FM1 SY0AAD55YN21FM1 SY0AAD56YJ16FM1
SY0AAD5YB23FM1 SY0AAD5YP04FM1 SY0AAD62YF18FM1
SY0AAD7YL20FM1