Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6566
Length(NT) : 659
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 6e-59
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 204 E_value: 1e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 204 E_value: 6e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig6566
TTGGTCGTTGGCAACCACACAAGTTACGAACCACAAACGCAAAAACGAAA
GCACTGCGAAAACATCTCCCAAAGAAAATCCTCAAAATGCCTTCCTATAT
CATAACCGTGAAGCCAGAGACCTCCGACTCGGAACTGCTAAAGATCAAGG
ACGACATCGTCGCCCAAGGTGGGAAAATCACTCACGAGTATTCGCTAATC
AGGGGGTTCTCGTGCGAACTCCCTGTTAACCAGGTTTCCACCTTGGAGAC
TCATAGACATGTGCAGAGCCTGGAGGTTGATGGCACGGTTACTACTCAGT
AGTGGTAAGTTGTGCGCTTTTCGGTCCAGACAATGAATAAAGGACACACA
CATTTCCTACTCCAGATGGATAGTCGTCCGCTGTGCATAATAATGTCGTG
GGTGATACCGGTATGGGGTGGTTTTGCCACTCGGTAGGGGTTGATTGTTT
CACGTCTATTCTGTGTTCTATTCTATTTGATTTTTCTCTCCTGTCTCTTG
CTCTGCGTTGCCCGTAGTGGGCAGGGTACGGGGGGCTTTGGAATAGGTTT
GGGAGGAAGAATGGATGGGGCTATGATGGGATGGATAATTGGTCTTGTAC
TGGGTCTGAAATAGAAAGTTTCGGTGTTGAATTGAGAGCTGATAGCCGTG
ATGCTGTTG

Sequences in the Contig:

SY0AAC38YM17FM1 SY0AAC42YL18FM1 SY0AAC9YH21FM1
SY0AAD10YM08FM1 SY0AAD35YP10FM1 SY0AAD57YJ06FM1
SY0AAD5YD04FM1 SY0AAD6YC02FM1