Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6468
Length(NT) : 520
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 4e-53
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 204 E_value: 7e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 204 E_value: 4e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig6468
TTGGCAACCACACAAGTTACGAACCACAAACGCAAAAACGAAAGCACTGC
GAAAACATCTCCCAAAGAAAATCCTCAAAATGCCTTCCTATATCATAACC
GTGAAGCCAGAGACCTCCGACTCGGAACTGCTAAAGATCAAGGACGACAT
CGTCGCCCAAGGTGGGAAAATCACTCACGAGTATTCGCTAATCAGGGGGT
TCTCGTGCGAACTCCCTGTTAACCAGGTTTCCACCTTGGAGACTCATAGA
CATGTGCAGAGCCTGGAGGTTGATGGCACGGTTACTACTCAGTAGTGACA
ATGAATAAAGGACACACACATTTCCTACTCCAGATGGATAGTCGTCCGCT
GTGCATAATAATGTCGTGGGTGATACCGGTATGGGGTGGTTTTGCCACTC
GGTAGGGGTTGATTGTTTCACGTCTATTCTGTGTTCTATTCTATTTGATT
TTTCTCTCCTGTCTCTTGCTCTGCGTTGCCCGTAGTGGGCAGGGTACGGG
GGGCTTTGGAATAGGTTTGG

Sequences in the Contig:

SY0AAD33YF07FM1 SY0AAD62YG24FM1