Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6338
Length(NT) : 694
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 3e-70
Numbers of ESTs : 26

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 204 E_value: 1e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 204 E_value: 7e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig6338
TTGGCCAACTTTTTTGTACAAAGTTGTCGTCAACAACCACACAAGTTACG
AACCACAAACGCAAAAACGAAAGCACTGCGAAAACATCTCCCAAAGAAAA
TCCTCAAAATGCCTTCCTATATCATAACCGTGAAGCCAGAGACCTCCGAC
TCGGAACTGCTAAAGATCAAGGACGACATCGTCGCCCAAGGTGGGAAAAT
CACTCACGAGTATTCGCTAATCAGGGGGTTCTCGTGCGAACTCCCTGTTA
ACCAGGTTTCCACCTTGGAGACTCATAGACATGTGCAGAGCCTGGAGGTT
GATGGCACGGTTACTACTCAGTAGTGGTGCGCTTTTCGGTCCAGACAATG
AATAAAGGACACACACATTTCCTACTCCAGATGGATAGTCGTCCGCTGTG
CATAATAATGTCGTGGGTGATACCGGTATGGGGTGGTTTTGCCACTCGGT
AGGGGTTGATTGTTTCACGTCTATTCTGTGTTCTATTCTATTTGATTTTT
CTCTCCTGTCTCTTGCTCTGCGTTGCCCGTAGTGGGCAGGGTACGGGGGG
CTTTGGAATAGGTTTGGGAGGAAGAATGGATGGGGCTATGATGGGATGGA
TAATTGGTCTTGTACTGGGTCTGAAATAGAAAGTTTCGGTGTTGAATTGA
GAGCTGATAGCCGTGATGCTGTTGAAGTACGGAGAGAGGTTGAA

Sequences in the Contig:

SY0AAA19YM20FM1 SY0AAA19YN05FM1 SY0AAA44YM22FM1
SY0AAA52YI13FM1 SY0AAB51YH23FM1 SY0AAB57YD12FM1
SY0AAB60YO21FM1 SY0AAC43YI04FM1 SY0AAC55YE18FM3
SY0AAC9YP10FM1 SY0AAD14YE04FM1 SY0AAD15YC18FM1
SY0AAD18YK02FM1 SY0AAD18YN22FM1 SY0AAD1YL08FM1
SY0AAD25YI05FM1 SY0AAD29YC03FM1 SY0AAD29YP07FM1
SY0AAD31YN20FM1 SY0AAD31YP12FM1 SY0AAD41YE15FM1
SY0AAD43YG11FM1 SY0AAD45YO11FM1 SY0AAD47YI21FM1
SY0AAD48YB10FM1 SY0AAD8YA05FM1