Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig633
Length(NT) : 858
Best Gene Model Blast : Link to GSTUMT00009120001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: putative transcription factor
Accession: cal:CaO19.10169 Score: 127 E_value: 8e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig633
TTGGGCATCCCCACGCTTTGTGATCGCTGTTTTCTTCCTGTGCGTGTGTG
GTCGTGTGTGAGGAGTGCTGTGGGTGTGCGTGTGTGGGGGAGTGCAGATA
AAAAGAACCCGGACAAAGGAGGAAGGAAGATTAACCCCAAGTCCTGCTTA
TACCATACCCATACCTCCACGGCTAGCACTCTTTCCAACTTCCTTACCCC
TTCTTACAACTCTCTCCTTGTGAGACACCTCGCTCTCTCTCACTCTCTCA
CTCATTTGCTCATTCACCTAACTACCCCCTCGCTTCCCCCCTCCTCGTCC
TCATCTTCTCCATTCTCCTAGCTTACGCAGGCAAGCCAACAAAGCTTCGA
AAAGAGGGAAAATTACAGTAATAAACAATAAGAACTGCGAAAATGTTCAC
ACAGTTTCGACTCCCGCCAGCGGAAGATCATCGTCCTGAGGATGGCGCGA
ACGCGAACTCCCGCACAACCCACCATTCCACTACAACTATCACCACCCGC
ACCGAGACTACTTCCTCAGTAAATCGGCCGAGAGGGTCCCGCGGCGTGAG
GAGGCCACTGAGCTGCGCTACGTGCATCAAGAAGAAGACAAAGTGTGATC
GGAAACTACCATGCGGAACATGCGTGAATAGGGGGGATGCTCTTCTCTGC
TCCTTTGGCCCCCAGGGGACTGGCTCTCCGTCAAGCTAAGGAATGTGCAG
AATTACGCCAGAGACTACGGAAACTCGAGAGCATGGTCCAGGAAATCCGC
GCCTCAGAGAAGGCTACGAAGGCCGGTTCACCGCCGAATGGCGGCGGTGG
TGGTGTTGGGAATAGCGACCTCTCGTCATTTATGCCCCCGCCACTGTCGC
CGGCTACT

Sequences in the Contig:

SY0AAA29YL14FM1 SY0AAB17YB12FM1 SY0AAC10YN15FM1